View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1408_high_99 (Length: 287)
Name: NF1408_high_99
Description: NF1408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1408_high_99 |
 | |
|
| [»] scaffold0405 (1 HSPs) |
| | |
|
Alignment Details
Target: chr5 (Bit Score: 160; Significance: 3e-85; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 160; E-Value: 3e-85
Query Start/End: Original strand, 1 - 172
Target Start/End: Original strand, 9695623 - 9695794
Alignment:
| Q |
1 |
aatatgggaattgtaattacttttatcacttttctgttactctgatttttccgtgttctgattttacttggatttatatcttgtgtttgctgatttgagc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
9695623 |
aatatgggaattgtaattacttttatcacttttctgtgactttgatttttccgtgttctgattttacttggatttatatctcgtgtttgctgatttgagc |
9695722 |
T |
|
| Q |
101 |
taattttggtgcattagactgagaagaatgcttcggaggaagaaggatctgagaagtccaagtctgaagtga |
172 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9695723 |
taattttggtgcattagactgagaagaatgcttcggaggaagaaggatctgagaagtccaagtctgaagtga |
9695794 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 158
Target Start/End: Complemental strand, 30439934 - 30439777
Alignment:
| Q |
1 |
aatatgggaattgtaattacttttatcacttttctgttactctgatttttccgtgttctgattttacttggatttatatcttgtgtttgctgatttgagc |
100 |
Q |
| |
|
|||||||||||||||||||||||||| |||| ||||||||| ||| |||| |||||| ||||||||||||||||||| | ||||||||||||| | |
|
|
| T |
30439934 |
aatatgggaattgtaattacttttataacttctctgttactgtgaatttttactgttcttattttacttggatttatattacctttttgctgatttgaac |
30439835 |
T |
|
| Q |
101 |
taattttggtgcattagactgagaagaatgcttcggaggaagaaggatctgagaagtc |
158 |
Q |
| |
|
|||||||| || |||||| ||||| |||||||| ||||||||||||| ||| ||||| |
|
|
| T |
30439834 |
taattttgatgtcttagaccgagaataatgcttcagaggaagaaggatttgataagtc |
30439777 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0405 (Bit Score: 73; Significance: 2e-33; HSPs: 1)
Name: scaffold0405
Description:
Target: scaffold0405; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 4 - 168
Target Start/End: Complemental strand, 14864 - 14700
Alignment:
| Q |
4 |
atgggaattgtaattacttttatcacttttctgttactctgatttttccgtgttctgattttacttggatttatatcttgtgtttgctgatttgagctaa |
103 |
Q |
| |
|
|||||||||||||||| || ||| |||||||||||||| ||| |||| || ||| ||||||||||||||||||| | ||||||||||||| |||| |
|
|
| T |
14864 |
atgggaattgtaattatttctataacttttctgttactgtgaatttttactgctcttattttacttggatttatattaactttttgctgatttgaactaa |
14765 |
T |
|
| Q |
104 |
ttttggtgcattagactgagaagaatgcttcggaggaagaaggatctgagaagtccaagtctgaa |
168 |
Q |
| |
|
||||| || |||||||||||||||||||||||| |||||||||||| | ||||| ||||||||| |
|
|
| T |
14764 |
ttttgatgtcttagactgagaagaatgcttcggaagaagaaggatctcataagtctaagtctgaa |
14700 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University