View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1408_low_101 (Length: 325)
Name: NF1408_low_101
Description: NF1408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1408_low_101 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 112; Significance: 1e-56; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 214 - 325
Target Start/End: Original strand, 7756314 - 7756425
Alignment:
| Q |
214 |
tctgtcttttggaaccccttttgttgctacaaaccttgttgttgatcttagtggttcacacttttgggttgattgttcttcaacaaaaacctcatcatct |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7756314 |
tctgtcttttggaaccccttttgttgctacaaaccttgttgttgatcttagtggttcacacttttgggttgattgttcttcaacaaaaacctcatcatct |
7756413 |
T |
|
| Q |
314 |
ttgagttcaatc |
325 |
Q |
| |
|
|||||||||||| |
|
|
| T |
7756414 |
ttgagttcaatc |
7756425 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University