View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1408_low_105 (Length: 321)
Name: NF1408_low_105
Description: NF1408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1408_low_105 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 30 - 315
Target Start/End: Complemental strand, 5223436 - 5223151
Alignment:
| Q |
30 |
tgatggttgcttttggaagatttattttgtactattgcaccctaaactcagcaaaaatgatgccgttattttatcaactccgcaagtaagttaaacttta |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5223436 |
tgatggttgcttttggaagatttattttgtactattgcaccctaaactcagcaaaaatgatgccgttattttatcaactccgcaagtaagttaaacttta |
5223337 |
T |
|
| Q |
130 |
attggaatccgttttagatgcatctgtctcagtatttgtttttcaaatttggatgcatctgcttctgcttatttaactaattttgtgttatttacttgtt |
229 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5223336 |
gttggaatccgttttggatgcatctgtctcagtatttgtttttcaaatttggatgcatctgcttctgcttatttaactaattttgtgttatttacttgtt |
5223237 |
T |
|
| Q |
230 |
gtttctgatcgttttaattttaatcatgtgtaactaatgactgaattagaggcagtgaaggtgttttagttgattatattattgga |
315 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
5223236 |
gtttccgatcgttttaattttaatcatgtgtaactaatgactgaattagaggcagtgaaggtgttttagttgattatagtattgga |
5223151 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University