View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1408_low_107 (Length: 318)
Name: NF1408_low_107
Description: NF1408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1408_low_107 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 77 - 307
Target Start/End: Original strand, 4354327 - 4354557
Alignment:
| Q |
77 |
taacacactatggatcctaaccctgctctcaaagccttgagtgaaagttttcagtgacagtaatcatatgcttcatgccttcactgcacaaagcgcatgg |
176 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
4354327 |
taacacactatggatcctaaacctgctctcaaagccttgagtgaaagttttcagtgacagtaatcatatgcttcatgccttcacttcacaaagcgcatgg |
4354426 |
T |
 |
| Q |
177 |
agttggatcacttcttcatgtgtgaatttgtccatgttcccctcttagttaaccatgcctctatcaccaatcaaatatattcatctcaaaaacaagctca |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4354427 |
agttggatcacttcttcatgtgtgaatttgtccatgttcccctcttagttaaccatgcctctatcaccaatcaaatatattcatctcaaaaacaagctca |
4354526 |
T |
 |
| Q |
277 |
atgtgctaagatagctaatagctctcttcat |
307 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
4354527 |
atgtgctaagatagctaatagctctcttcat |
4354557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University