View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1408_low_109 (Length: 314)
Name: NF1408_low_109
Description: NF1408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1408_low_109 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 28 - 226
Target Start/End: Original strand, 2094920 - 2095118
Alignment:
| Q |
28 |
gaaaggagccttggttaaacgggttaacgttgagagaaagatttaacatactttattgaatagcatacaggaaaaatacaataacgttgatgatgcaaaa |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
2094920 |
gaaaggagccttggttaaacgggttaacgttgagagaaagatttaacatactttattgaatagcataccggaaaaatacaataacgttgatgatgcaaaa |
2095019 |
T |
 |
| Q |
128 |
atgaattttagaaagggaagctccttaagactataatatagtgaaattcttctcatcattccttataattatcatatgtgattatttatatgctaaaga |
226 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2095020 |
atcaattttagaaagggaagctccttaagactataatatagtgaaattcttctcatcattccttataattatcatatgtgattatttatatgctaaaga |
2095118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University