View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1408_low_112 (Length: 311)
Name: NF1408_low_112
Description: NF1408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1408_low_112 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 171; Significance: 8e-92; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 171; E-Value: 8e-92
Query Start/End: Original strand, 1 - 247
Target Start/End: Complemental strand, 44013907 - 44013660
Alignment:
| Q |
1 |
cattcaataattttattttctgaaattattacggttttactgtcgtgtctgtcaggtgtttgtgttagtgtttcatagtgtctcagnnnnnnnnnnnn-a |
99 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
44013907 |
cattcaataattttattttctaaaattattacggttttactgtcgtgtctgtcaggtgtttgtgttagtgtttcatagtgtctcagttttatttttttta |
44013808 |
T |
|
| Q |
100 |
tataatcatgcatacttatatttacataatttattgatgtttcagttttgtctcttattattttannnnnnngactgaattttgtctcttgttaaattgc |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
44013807 |
tataatcatgcatacttatatttacataatttattgatgtttcagttttgtctcttattattttatttttttgactgaattttgtctcttgttaaattgc |
44013708 |
T |
|
| Q |
200 |
agggaattagctatgcaaagcttgcaaacttgcctcatattcttggac |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||| |||||| |
|
|
| T |
44013707 |
agggaattagctatgcaaagcttgcaaacttgcctcctattattggac |
44013660 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University