View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1408_low_114 (Length: 310)
Name: NF1408_low_114
Description: NF1408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1408_low_114 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 178; Significance: 5e-96; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 178; E-Value: 5e-96
Query Start/End: Original strand, 61 - 242
Target Start/End: Complemental strand, 33948117 - 33947936
Alignment:
| Q |
61 |
tcggttggaatgtgaaggggtgattatatagagaagggaagtggggaaggatagaggaaagaggggggtatgagtgggaaagattgacttttgagtgaag |
160 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33948117 |
tcggttggaatgtgaaggggtgattatatagagaagggaagtggggaaggatagaggaaagaggggggtatgagtgggaaagattgacttttgagtgaag |
33948018 |
T |
|
| Q |
161 |
gactagactggtttttagaaggagcagcctttactagactaccaattgttttccttgctatcattaattatagtatattctt |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
33948017 |
gactagactggtttttagaaggagcagcctttactagactaccaattgttttccttgctatcattaattatagtattttctt |
33947936 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University