View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1408_low_118 (Length: 310)
Name: NF1408_low_118
Description: NF1408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1408_low_118 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 110; Significance: 2e-55; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 105 - 242
Target Start/End: Complemental strand, 4295018 - 4294881
Alignment:
| Q |
105 |
gatatctatttgattttatttggatgtaaatttgaattttagtattcagaaataaaatcgaatttactcggcagaacttggagtgaaatcgataaactcg |
204 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| |||||||| ||| |||||||||||||||||||| |||||||||||||||||||||||||||| | |
|
|
| T |
4295018 |
gatatctatttgagtttatttggatgtaaatttgagttttagtactcaaaaataaaatcgaatttactccgcagaacttggagtgaaatcgataaacttg |
4294919 |
T |
 |
| Q |
205 |
caggaaattttgaacaaaacttttttatgttttcatct |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4294918 |
taggaaattttgaacaaaacttttttatgttttcatct |
4294881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 105 - 214
Target Start/End: Complemental strand, 4274419 - 4274307
Alignment:
| Q |
105 |
gatatctatttgattttatttggatgtaaatttgaattttagtattcagaaataaaa---tcgaatttactcggcagaacttggagtgaaatcgataaac |
201 |
Q |
| |
|
||||||||||||| |||||||||||||||| || |||||||||| ||||||| |||| |||||| |||||| || ||||||||||||||||||||||| |
|
|
| T |
4274419 |
gatatctatttgagtttatttggatgtaaactttaattttagtactcagaaaaaaaaaaatcgaatatactcgacaaaacttggagtgaaatcgataaac |
4274320 |
T |
 |
| Q |
202 |
tcgcaggaaattt |
214 |
Q |
| |
|
||||||||||||| |
|
|
| T |
4274319 |
tcgcaggaaattt |
4274307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 196 - 242
Target Start/End: Complemental strand, 4265217 - 4265171
Alignment:
| Q |
196 |
ataaactcgcaggaaattttgaacaaaacttttttatgttttcatct |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4265217 |
ataaactcgcaggaaattttgaacaaaacttttttatgttttcatct |
4265171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University