View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1408_low_122 (Length: 303)
Name: NF1408_low_122
Description: NF1408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1408_low_122 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 184; Significance: 1e-99; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 55 - 242
Target Start/End: Complemental strand, 5056544 - 5056357
Alignment:
| Q |
55 |
agtgaagaggtttttcttctgcattttgatcaatttgtctcacatctttatgctctttcattaggctcttcccatactgtgctgatttcagttctatggt |
154 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
5056544 |
agtgaagaggtttttcttctgcattttgatcaatttgtctcacatctttatgctctttcattaggctcttcccatattgtgctgatttcagttctatggt |
5056445 |
T |
 |
| Q |
155 |
tccaggtgagttcatcacctttctaaatgaacttagacttttaagcgaacagttcaaattgtagcgagcaagtttgttttcttcatct |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5056444 |
tccaggtgagttcatcacctttctaaatgaacttagacttttaagcgaacagttcaaattgtagcgagcaagtttgttttcttcatct |
5056357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 119 - 185
Target Start/End: Original strand, 5185718 - 5185784
Alignment:
| Q |
119 |
gctcttcccatactgtgctgatttcagttctatggttccaggtgagttcatcacctttctaaatgaa |
185 |
Q |
| |
|
|||||||| ||| |||||||||||||||||||||| | ||| | | ||||| |||||||||||||| |
|
|
| T |
5185718 |
gctcttcctatattgtgctgatttcagttctatggctacagctcaattcatttcctttctaaatgaa |
5185784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University