View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1408_low_125 (Length: 301)
Name: NF1408_low_125
Description: NF1408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1408_low_125 |
 | |
|
| [»] scaffold0364 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0364 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: scaffold0364
Description:
Target: scaffold0364; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 103 - 299
Target Start/End: Original strand, 12156 - 12351
Alignment:
| Q |
103 |
caattaattggtgtgtctaacacattactaaattaaatcctgtggatttatctaatagaattttactgccacattgcttagaaacatatacattttccag |
202 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
12156 |
caattaattggtgtgtc-aacacataactaaattaaatcttgtggatttatctaatagaattttactgccacattgcttaaaaacatatacattttccag |
12254 |
T |
|
| Q |
203 |
ctgtcaaggtctcgtatgaataaataagacacatcggtttatggggaagctcgcacatatcgtttggacaatcgttggcactaagacatctaataaa |
299 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12255 |
ctgtcaaggtctcatatgaataaataagacacatcggtttctggggaagctcgcacatatcgtttggacaatcgttggcactaagacatctaataaa |
12351 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University