View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1408_low_126 (Length: 301)
Name: NF1408_low_126
Description: NF1408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1408_low_126 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 85 - 301
Target Start/End: Original strand, 51525712 - 51525926
Alignment:
| Q |
85 |
acttggacactaggagaaccatatattttgcgctaaatgaacaatgatactcccattgtcatcattgcatcaagaattaaaatgttgtttgattgattgc |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51525712 |
acttggacactaggagaaccatatattttgcgctaaatgaacaatgatactcccattgtcatcattgcatcaagaattaaaatgttgtttgattgattgc |
51525811 |
T |
|
| Q |
185 |
aaggttctttcaacttatgctttctgtctcccaaaaactatgaaaatgttggcattagtaaactcaaagcctgctgatacggcaaataaggatacattta |
284 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| || |
|
|
| T |
51525812 |
aaggttctttcaacttatgctttctgtctcccaaaaactatgaaaatgttggcattagtaaactcaaagcctgctgatacggcaaataaggatccatata |
51525911 |
T |
|
| Q |
285 |
ctctgtgaaaatgtttt |
301 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
51525912 |
--ctgtgaaaatgtttt |
51525926 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University