View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1408_low_127 (Length: 300)
Name: NF1408_low_127
Description: NF1408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1408_low_127 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 181; Significance: 8e-98; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 181; E-Value: 8e-98
Query Start/End: Original strand, 30 - 236
Target Start/End: Original strand, 34680324 - 34680527
Alignment:
| Q |
30 |
attgtatccatagtttatgtgattaagaaaacatccaatacaccgtcactgaacttcaatagtcgaaattcagattgtcttcagcatctgcacaatgcag |
129 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34680324 |
attgcatccatagtttatgtgattaagaaaacatccaatacaccgtcactgaacttcaatagtcgaaattcagattgtcttcagcatctgcacaatgcag |
34680423 |
T |
 |
| Q |
130 |
aagttgtggaaaccattagatctaacattcttcacaacgtttgcacaatgcagttgctatagagaatctaagtgcgtgtcactaaattctacaaagaatc |
229 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
34680424 |
aagttgtgggaaccattagatctaacattcttcacaacgtttgcacaatgcagttgctatagagaatctaagt---tgtcactaaattcttcaaagaatc |
34680520 |
T |
 |
| Q |
230 |
taatcat |
236 |
Q |
| |
|
||||||| |
|
|
| T |
34680521 |
taatcat |
34680527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University