View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1408_low_129 (Length: 296)
Name: NF1408_low_129
Description: NF1408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1408_low_129 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 149; Significance: 1e-78; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 56 - 241
Target Start/End: Complemental strand, 51953581 - 51953397
Alignment:
| Q |
56 |
tatgaaccataaatcaaaagcatttgtatgtgttgagannnnnnnncaacagaatcttttatcaagcattatcccattgggtaaggtcaacaatgtggat |
155 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
51953581 |
tatgaaccataaatcaaaagcatttgtatgtgttgagattttttt-caacagaatcttttatcaagcattgtcccattgggtaaggtcaacaatgtggat |
51953483 |
T |
|
| Q |
156 |
tgaatgacatgataactctatcatgaaataagttcaaagaccatttacatcttaattaatcttaaagtttgatttgcagttcttct |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
51953482 |
tgaatgacatgataactctatcatgaaataagttcaaagaccatttacatcttaattaatcttaaagtttgatttgtagttcttct |
51953397 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University