View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1408_low_131 (Length: 292)
Name: NF1408_low_131
Description: NF1408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1408_low_131 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 6 - 276
Target Start/End: Original strand, 53158156 - 53158426
Alignment:
| Q |
6 |
aagctatgtctcgtgtcctccatctttctccaactccggcgaccgtcttctagtcggctccggcacctccgtcgctatcttctccaccaccactgcctta |
105 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
53158156 |
aagctatgtctcgtgttctccatctttctccaactccggcgaccgtcttctagtcggctccggcacctccgtcgctatcttctccaccaccaccgcctta |
53158255 |
T |
|
| Q |
106 |
caagtttcctcccttgacggtcacaccgatactgtcacctccgtcatcgtcgtccccggttcaaacattgttacctactgttggacctcttccctcgacg |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53158256 |
caagtttcctcccttgacggtcacaccgatactgtcacctccgtcatcgtcgtccccggttcaaacattgttacctactgttggacctcttccctcgacg |
53158355 |
T |
|
| Q |
206 |
gcaccattcgccattgggatttctcccttctcaaatgcatcaaaataattgacctaaaacttcccattttc |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
53158356 |
gcaccattcgccattgggatttctcccttctcaaatgcatcaaaataattgatctaaaacttcccattttc |
53158426 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University