View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1408_low_14 (Length: 543)
Name: NF1408_low_14
Description: NF1408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1408_low_14 |
 |  |
|
| [»] scaffold0168 (1 HSPs) |
 |  |  |
|
| [»] scaffold0187 (4 HSPs) |
 |  |  |
|
| [»] scaffold0223 (1 HSPs) |
 |  |  |
|
| [»] scaffold0258 (1 HSPs) |
 |  |  |
|
| [»] scaffold0057 (5 HSPs) |
 |  |  |
|
| [»] scaffold1176 (1 HSPs) |
 |  |  |
|
| [»] scaffold0015 (1 HSPs) |
 |  |  |
|
| [»] scaffold0311 (1 HSPs) |
 |  |  |
|
| [»] scaffold0049 (1 HSPs) |
 |  |  |
|
| [»] scaffold0180 (1 HSPs) |
 |  |  |
|
| [»] scaffold0005 (1 HSPs) |
 |  |  |
|
| [»] scaffold0036 (1 HSPs) |
 |  |  |
|
| [»] scaffold0018 (1 HSPs) |
 |  |  |
|
| [»] scaffold0254 (1 HSPs) |
 |  |  |
|
| [»] scaffold0954 (1 HSPs) |
 |  |  |
|
| [»] scaffold0024 (1 HSPs) |
 |  |  |
|
| [»] scaffold0167 (1 HSPs) |
 |  |  |
|
| [»] scaffold0194 (1 HSPs) |
 |  |  |
|
| [»] scaffold0031 (1 HSPs) |
 |  |  |
|
| [»] scaffold0116 (1 HSPs) |
 |  |  |
|
| [»] scaffold0867 (1 HSPs) |
 |  |  |
|
| [»] scaffold0050 (1 HSPs) |
 |  |  |
|
| [»] scaffold0028 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr3 (Bit Score: 303; Significance: 1e-170; HSPs: 84)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 303; E-Value: 1e-170
Query Start/End: Original strand, 86 - 443
Target Start/End: Original strand, 39203439 - 39203797
Alignment:
| Q |
86 |
aacctgtgtttaattcacttcattatttgacaataataatgtatagtt-ctctgaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaa |
184 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| | ||| |||||||||||||||||||||| | |
|
|
| T |
39203439 |
aacctgtgttcaattcacttcattatttgacaataataatgtatagtttctctgaggggtaaccttggcacaacttgtaaagttgttgtcatgtgactga |
39203538 |
T |
 |
| Q |
185 |
aaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcat |
284 |
Q |
| |
|
|||||||| |||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
39203539 |
aaggtcacaggttcaagtccttgaaacagcctcttgtgtaaaacagggtaaggttgcgtacaatacaccaaatggtgggaccccttcccggaccttgcat |
39203638 |
T |
 |
| Q |
285 |
atgcgggagctctagtgcaccgggttgccctttaatgtatagtttctctctagagttccgaaacagttaattttggttgaaattctcaatgaattagttt |
384 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39203639 |
atgcgggagctttagtgcaccgggttgccctttaatgtatagtttctctctagagttccgaaacagttaattttggttgaaattctcaatgaattagttt |
39203738 |
T |
 |
| Q |
385 |
atcttcatgaaaacttatagaaacaaacagcttatgcaaaagttatttatgtttaccct |
443 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
39203739 |
atcttcatgaaaacttatagaaacaaacagcttatacaaaagttatttatgtttaccct |
39203797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 157; E-Value: 3e-83
Query Start/End: Original strand, 137 - 317
Target Start/End: Original strand, 1217065 - 1217245
Alignment:
| Q |
137 |
tgaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaag |
236 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||| ||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
1217065 |
tgaggggtaaccttggcgcaactggtaaagttgtagtcatgtcactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaacagggtaag |
1217164 |
T |
 |
| Q |
237 |
gctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1217165 |
gctgcgtacaatacaccaaatggcgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
1217245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 151; E-Value: 1e-79
Query Start/End: Original strand, 142 - 316
Target Start/End: Complemental strand, 22123092 - 22122918
Alignment:
| Q |
142 |
ggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaaggctgc |
241 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||| ||||||| ||||||||||||||| |||||| ||||||||||||||||||||||||||| |
|
|
| T |
22123092 |
ggtaaccttggcgccactggtaaatttgttgtcatgtgactgaaaggtcgcgggttcaagtcctggaaacagtctcttgtgtaaaacagggtaaggctgc |
22122993 |
T |
 |
| Q |
242 |
gtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctt |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
22122992 |
gtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgagagctctagtgcaccgggttgccctt |
22122918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 141; E-Value: 1e-73
Query Start/End: Original strand, 136 - 317
Target Start/End: Complemental strand, 40272995 - 40272812
Alignment:
| Q |
136 |
ctgaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggt |
233 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||| ||||||| |||||||||||||| ||||| |||||||||||||| |||||| |
|
|
| T |
40272995 |
ctgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcatgggttcaagtcctggaaacaacctcttgtgtaaaaaacagggt |
40272896 |
T |
 |
| Q |
234 |
aaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
40272895 |
aaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
40272812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 136; E-Value: 1e-70
Query Start/End: Original strand, 137 - 316
Target Start/End: Complemental strand, 7697067 - 7696893
Alignment:
| Q |
137 |
tgaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaag |
236 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||| |
|
|
| T |
7697067 |
tgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctggaaacagtctcttgtgtaaaacagggtaag |
7696968 |
T |
 |
| Q |
237 |
gctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctt |
316 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||| ||||||||| |||||||||||||||||||||| ||||| |
|
|
| T |
7696967 |
gctgcgtacaatacaccaaatgg-----ccccttcccggacactgcatatgtgggagctctagtgcaccgggtttccctt |
7696893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 134; E-Value: 2e-69
Query Start/End: Original strand, 138 - 317
Target Start/End: Complemental strand, 13730785 - 13730602
Alignment:
| Q |
138 |
gaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaa |
235 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||| |||||||||||| |
|
|
| T |
13730785 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaa |
13730686 |
T |
 |
| Q |
236 |
ggctgcgtacaatacacca--aatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
||||| ||||||||||||| ||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
13730685 |
ggctgtgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttgcccttt |
13730602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 132; E-Value: 3e-68
Query Start/End: Original strand, 137 - 317
Target Start/End: Complemental strand, 13628975 - 13628790
Alignment:
| Q |
137 |
tgaggggtaaccttggcgccactggtaaa-gttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaa--aacagggt |
233 |
Q |
| |
|
||||||||||||||||| | ||||||||| ||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
13628975 |
tgaggggtaaccttggcacaactggtaaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaagaaacagggt |
13628876 |
T |
 |
| Q |
234 |
aaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
13628875 |
aaggctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
13628790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 131; E-Value: 1e-67
Query Start/End: Original strand, 138 - 317
Target Start/End: Complemental strand, 46421218 - 46421034
Alignment:
| Q |
138 |
gaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaa |
235 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||| |||||||||||| |
|
|
| T |
46421218 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgacttaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaa |
46421119 |
T |
 |
| Q |
236 |
ggctgcgtacaatacacca--aatggtgggaccccttcccggaccctgcatatgcgggagctct-agtgcaccgggttgcccttt |
317 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||| | |||||||||| ||||||||| |
|
|
| T |
46421118 |
ggctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagctttaagtgcaccggtttgcccttt |
46421034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 129; E-Value: 2e-66
Query Start/End: Original strand, 139 - 317
Target Start/End: Complemental strand, 29366902 - 29366720
Alignment:
| Q |
139 |
aggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaag |
236 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| | ||||||||||||| |
|
|
| T |
29366902 |
aggggtaaccttggcgtaactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctggaaacagcctcttgtataaaaaacagggtaag |
29366803 |
T |
 |
| Q |
237 |
gctgcgtacaatacacca--aatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||| |||| ||||||| |||||||| |||||||||||| |
|
|
| T |
29366802 |
gctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgtgggagctttagtgcactgggttgcccttt |
29366720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 125; E-Value: 4e-64
Query Start/End: Original strand, 137 - 316
Target Start/End: Original strand, 22609742 - 22609921
Alignment:
| Q |
137 |
tgaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa-cagggtaa |
235 |
Q |
| |
|
||||||||||||||||||| || ||||||||||||||||||||||| ||||| ||||||||||||| || |||||||||||||||||||| |||||||| |
|
|
| T |
22609742 |
tgaggggtaaccttggcgcaac-ggtaaagttgttgtcatgtgactgtaaggtaacgggttcaagtcttggaaacagcctcttgtgtaaaaacagggtaa |
22609840 |
T |
 |
| Q |
236 |
ggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctt |
316 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
22609841 |
ggctgcgtacaatacaccaaatggtgggaccccttcccggaccttgcgtatgcgggagcttcagtgcaccgggttgccctt |
22609921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 122; E-Value: 2e-62
Query Start/End: Original strand, 137 - 315
Target Start/End: Complemental strand, 8247871 - 8247688
Alignment:
| Q |
137 |
tgaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
8247871 |
tgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggta |
8247772 |
T |
 |
| Q |
235 |
aggctgcgtacaatacacca--aatggtgggaccccttcccggaccctgcatatgcgggagctct-agtgcaccgggttgccct |
315 |
Q |
| |
|
||| |||||||||||||||| ||||||||||| |||||||||||||||| |||||||||||| | ||||||| |||||||||| |
|
|
| T |
8247771 |
aggttgcgtacaatacaccaataatggtgggactccttcccggaccctgcgtatgcgggagctttaagtgcactgggttgccct |
8247688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 122; E-Value: 2e-62
Query Start/End: Original strand, 137 - 317
Target Start/End: Original strand, 16735416 - 16735597
Alignment:
| Q |
137 |
tgaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgt-gtaaaacagggtaa |
235 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||| || |||||||||||||||||| |||||||||||||| | |||||||||||| |
|
|
| T |
16735416 |
tgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaa |
16735515 |
T |
 |
| Q |
236 |
ggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||| ||||||| |||| ||||||| |||||||||||| |
|
|
| T |
16735516 |
ggctgcgtacaatacaccaaatggtgggaccccttcccggacactgcgtatgcggtagcttcagtgcactgggttgcccttt |
16735597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 122; E-Value: 2e-62
Query Start/End: Original strand, 138 - 317
Target Start/End: Complemental strand, 52926391 - 52926219
Alignment:
| Q |
138 |
gaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaagg |
237 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
52926391 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgta-------gtaagg |
52926299 |
T |
 |
| Q |
238 |
ctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||| |||||||||||| ||| ||||||||||||||||| |
|
|
| T |
52926298 |
ctgcgtacaatacaccaaatggtgggacaccttcccggaccctgcgtatgcgggagctttagcgcaccgggttgcccttt |
52926219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 120; E-Value: 4e-61
Query Start/End: Original strand, 151 - 317
Target Start/End: Original strand, 26869696 - 26869863
Alignment:
| Q |
151 |
ggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa-cagggtaaggctgcgtacaata |
249 |
Q |
| |
|
||||| |||||||||||||||||||||||||| ||||||||| ||||||||||||| ||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
26869696 |
ggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacaggttcaagtcctggaaacagcctctggtgtaaaaacagggtaaggctgcgtacaata |
26869795 |
T |
 |
| Q |
250 |
caccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
||||||||||||||||||||| ||||||| ||| |||||||||||| | ||||||||||||||||||| |
|
|
| T |
26869796 |
caccaaatggtgggaccccttgccggaccatgcgtatgcgggagctttggtgcaccgggttgcccttt |
26869863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 119; E-Value: 1e-60
Query Start/End: Original strand, 138 - 317
Target Start/End: Complemental strand, 12914216 - 12914035
Alignment:
| Q |
138 |
gaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaa |
235 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| ||||||| ||||||||| |||||||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
12914216 |
gaggggtaaccttggcgcaactggtaaagttgttgtaatgtgaccgaaaggtcacaagttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaa |
12914117 |
T |
 |
| Q |
236 |
ggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
||| |||||||||||||||||||||| ||||||||||| ||||||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
12914116 |
ggcggcgtacaatacaccaaatggtgagaccccttcccagaccctgcatatgcgggagcttcaatgcaccgggttgcccttt |
12914035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 119; E-Value: 1e-60
Query Start/End: Original strand, 191 - 317
Target Start/End: Original strand, 31592878 - 31593004
Alignment:
| Q |
191 |
acgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgg |
290 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
31592878 |
acgggttcaagtcctggaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggactccttcccggaccctgcatatgcgg |
31592977 |
T |
 |
| Q |
291 |
gagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
31592978 |
gagctctagtgcaccgggttgcccttt |
31593004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 110; E-Value: 3e-55
Query Start/End: Original strand, 138 - 306
Target Start/End: Complemental strand, 6412002 - 6411833
Alignment:
| Q |
138 |
gaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa-cagggtaag |
236 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||||||||||| ||| | |||||| ||||||||||| || |||||||||||||||||||| ||||||||| |
|
|
| T |
6412002 |
gaggggtaaccttgacgcaactggtaaagttgttgtcatgtaactgataggtcatgggttcaagtcttgtaaacagcctcttgtgtaaaaacagggtaag |
6411903 |
T |
 |
| Q |
237 |
gctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccg |
306 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| |||| ||| |||||||||||| |||||||||| |
|
|
| T |
6411902 |
gctgcgtacaatacaccaaatgatgggaccccttcccagaccttgcgtatgcgggagctttagtgcaccg |
6411833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 106; E-Value: 9e-53
Query Start/End: Original strand, 137 - 315
Target Start/End: Original strand, 26573103 - 26573282
Alignment:
| Q |
137 |
tgaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggta |
234 |
Q |
| |
|
||||||| | ||||||||| || |||||||||||||||| |||||| ||||||||||||||||||||||| |||||||||| ||||||||| ||||||| |
|
|
| T |
26573103 |
tgagggggacccttggcgcaac-ggtaaagttgttgtcacgtgactgaaaggtcacgggttcaagtcctggaaacagcctcctgtgtaaaaaacagggta |
26573201 |
T |
 |
| Q |
235 |
aggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccct |
315 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| ||||||||||||| |||||| ||||| ||||||||| || |||||| |
|
|
| T |
26573202 |
aggctgcgtacaatacaccaattggtgggaccccatcccggaccctgcgtatgcgtgagctttagtgcaccaggctgccct |
26573282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 103; E-Value: 5e-51
Query Start/End: Original strand, 211 - 317
Target Start/End: Original strand, 15797271 - 15797377
Alignment:
| Q |
211 |
cagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggtt |
310 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
15797271 |
cagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgtgggagctctagtgcaccgggtt |
15797370 |
T |
 |
| Q |
311 |
gcccttt |
317 |
Q |
| |
|
||||||| |
|
|
| T |
15797371 |
gcccttt |
15797377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 102; E-Value: 2e-50
Query Start/End: Original strand, 137 - 317
Target Start/End: Complemental strand, 5173903 - 5173719
Alignment:
| Q |
137 |
tgaggggtaaccttggcgccactggtaaa-gttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt-aaaacagggta |
234 |
Q |
| |
|
||||||||||||||||||| ||| ||||| ||||||||||||||||| ||||||||||||||||||||||| ||||| |||||||||| |||||| ||| |
|
|
| T |
5173903 |
tgaggggtaaccttggcgcaactcgtaaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaaacaaagta |
5173804 |
T |
 |
| Q |
235 |
aggctgcgtacaatacacc--aaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
||| ||| | ||||||||| |||||||||| |||||||||||||| ||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
5173803 |
aggttgcatgcaatacaccaaaaatggtggggccccttcccggaccttgcgtatgcgggagctttagtgcaccgggttgcccttt |
5173719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 98; E-Value: 5e-48
Query Start/End: Original strand, 138 - 317
Target Start/End: Complemental strand, 4495845 - 4495676
Alignment:
| Q |
138 |
gaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaa |
235 |
Q |
| |
|
||||||||||||| |||| |||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||| |||||| |||||||||||| |
|
|
| T |
4495845 |
gaggggtaaccttcgcgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctgaaaatagcctattgtgtaaaaaacagggtaa |
4495746 |
T |
 |
| Q |
236 |
ggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
4495745 |
ggctgcgtacaatacaccaaatggtg------------ggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
4495676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 98; E-Value: 5e-48
Query Start/End: Original strand, 137 - 300
Target Start/End: Original strand, 9607178 - 9607345
Alignment:
| Q |
137 |
tgaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggta |
234 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||||||||||||||| |||||||| ||||||||||||| ||||||||||||| || ||||||||||| |
|
|
| T |
9607178 |
tgaggggtaaccttggcgcaacttgtaaagttgttgtcatgtgactgaaaggtcatcggttcaagtcctggaaacagcctcttgcgtaaaaaacagggta |
9607277 |
T |
 |
| Q |
235 |
aggctgcgtacaatacacca--aatggtgggaccccttcccggaccctgcatatgcgggagctctagt |
300 |
Q |
| |
|
|||||||||| ||||||||| |||| |||||||||||||| ||||| ||||||||||||||| |||| |
|
|
| T |
9607278 |
aggctgcgtagaatacaccaataatgttgggaccccttcccagaccccgcatatgcgggagctttagt |
9607345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 97; E-Value: 2e-47
Query Start/End: Original strand, 161 - 317
Target Start/End: Complemental strand, 34420802 - 34420643
Alignment:
| Q |
161 |
gtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaaggctgcgtacaatacacc-aaat |
257 |
Q |
| |
|
||||||||||||||| |||||| ||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||| ||||||| |||| |
|
|
| T |
34420802 |
gtaaagttgttgtcacgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtaccatacaccaaaat |
34420703 |
T |
 |
| Q |
258 |
ggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
||||||||||||||||||||| ||| |||| ||||||| |||||||| || |||||||| |
|
|
| T |
34420702 |
ggtgggaccccttcccggaccttgcgtatgtgggagctttagtgcacatggctgcccttt |
34420643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 96; E-Value: 8e-47
Query Start/End: Original strand, 170 - 317
Target Start/End: Original strand, 516417 - 516569
Alignment:
| Q |
170 |
ttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaaggctgcgtacaatacacc---aaatggtggga |
264 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||| |||||| ||| |||||| |||| |
|
|
| T |
516417 |
ttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggctgcgcacaataaaccaaaaaatggcggga |
516516 |
T |
 |
| Q |
265 |
ccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
||||||||| |||||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
516517 |
ccccttccccgaccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
516569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 94; E-Value: 1e-45
Query Start/End: Original strand, 220 - 317
Target Start/End: Complemental strand, 34771461 - 34771364
Alignment:
| Q |
220 |
gtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
34771461 |
gtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggctgcccttt |
34771364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 89; E-Value: 1e-42
Query Start/End: Original strand, 202 - 317
Target Start/End: Original strand, 54484730 - 54484848
Alignment:
| Q |
202 |
tcctgaaaacagcctcttgtgtaaaa---cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctcta |
298 |
Q |
| |
|
||||| |||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| || |
|
|
| T |
54484730 |
tcctggaaacagcctcttgtgtaaaaaaacaaggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagcttta |
54484829 |
T |
 |
| Q |
299 |
gtgcaccgggttgcccttt |
317 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
54484830 |
gtgcaccgggttgcccttt |
54484848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 88; E-Value: 5e-42
Query Start/End: Original strand, 138 - 244
Target Start/End: Complemental strand, 10870132 - 10870025
Alignment:
| Q |
138 |
gaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt-aaaacagggtaag |
236 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||| ||||||||||||| |
|
|
| T |
10870132 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaacagggtaag |
10870033 |
T |
 |
| Q |
237 |
gctgcgta |
244 |
Q |
| |
|
|||||||| |
|
|
| T |
10870032 |
gctgcgta |
10870025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 87; E-Value: 2e-41
Query Start/End: Original strand, 190 - 318
Target Start/End: Complemental strand, 10795554 - 10795422
Alignment:
| Q |
190 |
cacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcata |
285 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||| ||||||||| || |
|
|
| T |
10795554 |
cacgggttcaagtcctggaaacagcctcttgtgtaaaagacagggtaaggctgcgtacaatacaccaaaaatggtgggaccccttcctggaccctgcgta |
10795455 |
T |
 |
| Q |
286 |
tgcgggagctctagtgcaccgggttgcccttta |
318 |
Q |
| |
|
|||||||||| |||||||| |||||||||||| |
|
|
| T |
10795454 |
tgcgggagcttcagtgcaccaggttgcccttta |
10795422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 87; E-Value: 2e-41
Query Start/End: Original strand, 147 - 317
Target Start/End: Complemental strand, 53996737 - 53996565
Alignment:
| Q |
147 |
ccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgta |
244 |
Q |
| |
|
||||||||| || |||||| |||||||||| ||||| |||||||||| ||||||||| || ||||| |||||||||||||| |||||||||||||| || |
|
|
| T |
53996737 |
ccttggcgctac-ggtaaatttgttgtcatttgactgaaaggtcacgtgttcaagtcgtggaaacaacctcttgtgtaaaaaacagggtaaggctgctta |
53996639 |
T |
 |
| Q |
245 |
caatacaccaaa-tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|||||||||||| ||||||||||||||||| ||| |||| |||| ||||||| |||||||||||| |||||||| |
|
|
| T |
53996638 |
caatacaccaaaatggtgggaccccttccctgacactgcgtatgtgggagctttagtgcaccgggctgcccttt |
53996565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 86; E-Value: 7e-41
Query Start/End: Original strand, 194 - 317
Target Start/End: Original strand, 14986989 - 14987116
Alignment:
| Q |
194 |
ggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcg |
289 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||| |||||||||| |||||||||| |
|
|
| T |
14986989 |
ggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggacccattcccggaccttgcatatgcg |
14987088 |
T |
 |
| Q |
290 |
ggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|||||| |||||||||||||| |||||| |
|
|
| T |
14987089 |
ggagctttagtgcaccgggtttcccttt |
14987116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 83; E-Value: 5e-39
Query Start/End: Original strand, 139 - 317
Target Start/End: Complemental strand, 25517353 - 25517170
Alignment:
| Q |
139 |
aggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagt--cctgaaaacagcctcttgtgtaaaa---cagggt |
233 |
Q |
| |
|
|||| |||||||||||| |||||||||||||||||||||||||| |||||||| || | | | |||| ||||| |||||||||||||| || | | |
|
|
| T |
25517353 |
agggataaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacaggatgatgggacctggaaacatcctcttgtgtaaaaaaacaagat |
25517254 |
T |
 |
| Q |
234 |
aaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
| ||||||||||||||||| ||||||||||||||||||||||| ||||| ||||| |||||| ||||||||||||||||||||| |
|
|
| T |
25517253 |
atggctgcgtacaatacacaaaatggtgggaccccttcccggatcctgcgtatgctggagctttagtgcaccgggttgcccttt |
25517170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 83; E-Value: 5e-39
Query Start/End: Original strand, 164 - 295
Target Start/End: Complemental strand, 30928302 - 30928169
Alignment:
| Q |
164 |
aagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaaggctgcgtacaatacaccaaatggtg |
261 |
Q |
| |
|
||||| ||||||||||||| ||||||||||||||||||||||| |||||||||||||||| |||||| ||||||| || ||| |||||||||| ||| | |
|
|
| T |
30928302 |
aagttcttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacaaggtaaggttgtgtaaaatacaccaattggcg |
30928203 |
T |
 |
| Q |
262 |
ggaccccttcccggaccctgcatatgcgggagct |
295 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |
|
|
| T |
30928202 |
ggaccccttcccggaccctgcatatgtgggagct |
30928169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 83; E-Value: 5e-39
Query Start/End: Original strand, 173 - 301
Target Start/End: Original strand, 33926094 - 33926224
Alignment:
| Q |
173 |
tcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt-aaaacagggtaaggctgcgtacaatacacca-aatggtgggacccctt |
270 |
Q |
| |
|
|||||||||| |||||||| |||||||||||||| ||| |||||||||||| ||||||||||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
33926094 |
tcatgtgactgaaaggtcatgggttcaagtcctggaaatagcctcttgtgtaaaaacagggtaaggctgtgtacaatacaccataatggtgggacccctt |
33926193 |
T |
 |
| Q |
271 |
cccggaccctgcatatgcgggagctctagtg |
301 |
Q |
| |
|
|| |||||||||||||||| ||||| ||||| |
|
|
| T |
33926194 |
cctggaccctgcatatgcgagagctttagtg |
33926224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 81; E-Value: 7e-38
Query Start/End: Original strand, 147 - 307
Target Start/End: Complemental strand, 45949012 - 45948848
Alignment:
| Q |
147 |
ccttggcgccactggtaaagttgttgtcatgtgactaaa---aggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaaca--gggtaaggctgc |
241 |
Q |
| |
|
||||||||| || ||| |||||||| |||||||||| || ||||||||||||||| ||||| ||||| |||||||||||||| | |||||||||||| |
|
|
| T |
45949012 |
ccttggcgcaac-ggtgaagttgttttcatgtgactgaaggaaggtcacgggttcaattcctggaaacaacctcttgtgtaaaaaatagggtaaggctgc |
45948914 |
T |
 |
| Q |
242 |
gtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgg |
307 |
Q |
| |
|
||||||||||||| ||||||||||||||| |||||||||| |||||||||||| ||||||||||| |
|
|
| T |
45948913 |
atacaatacaccaattggtgggaccccttctcggaccctgcgtatgcgggagctttagtgcaccgg |
45948848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 80; E-Value: 3e-37
Query Start/End: Original strand, 165 - 313
Target Start/End: Original strand, 7942993 - 7943143
Alignment:
| Q |
165 |
agttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgg |
262 |
Q |
| |
|
|||||||||||||||||| |||||||||| ||||||||||| ||||||| |||||| ||||| ||||||||| |||||||||||||| |||||||||| |
|
|
| T |
7942993 |
agttgttgtcatgtgactggaaggtcacggattcaagtcctggaaacagcatcttgtctaaaaaacagggtaagactgcgtacaatacatcaaatggtgg |
7943092 |
T |
 |
| Q |
263 |
gaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcc |
313 |
Q |
| |
|
|| ||||| || |||| ||| |||||||||||| |||||||| |||||||| |
|
|
| T |
7943093 |
gatccctttccagaccatgcgtatgcgggagctttagtgcactgggttgcc |
7943143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 80; E-Value: 3e-37
Query Start/End: Original strand, 208 - 317
Target Start/End: Complemental strand, 49013586 - 49013473
Alignment:
| Q |
208 |
aaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctctagtgca |
303 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||| ||||||||| ||||||| |
|
|
| T |
49013586 |
aaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatacgcgggagctttagtgca |
49013487 |
T |
 |
| Q |
304 |
ccgggttgcccttt |
317 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
49013486 |
ccgggttgcccttt |
49013473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 78; E-Value: 4e-36
Query Start/End: Original strand, 207 - 318
Target Start/End: Complemental strand, 45786328 - 45786213
Alignment:
| Q |
207 |
aaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcatatgcgggagctctagtgc |
302 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||| |||||| |||||| |
|
|
| T |
45786328 |
aaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaaaatggtgggaccccttcccggaccctgcgaatgctggagctttagtgc |
45786229 |
T |
 |
| Q |
303 |
accgggttgcccttta |
318 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
45786228 |
accgggttgcccttta |
45786213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 77; E-Value: 2e-35
Query Start/End: Original strand, 161 - 317
Target Start/End: Original strand, 25944468 - 25944627
Alignment:
| Q |
161 |
gtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaaggctgcgtacaatacacc-aaat |
257 |
Q |
| |
|
||||||||||||||| |||||| |||||||| |||||||||||||| |||| |||||| |||| ||||| ||| ||||||| |||||||||||| |||| |
|
|
| T |
25944468 |
gtaaagttgttgtcacgtgactgaaaggtcatgggttcaagtcctggaaaccgcctctcgtgtaaaaaactgggcaaggctgagtacaatacaccaaaat |
25944567 |
T |
 |
| Q |
258 |
ggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|||||||||||||||| |||||||| |||| ||||||| ||| ||||| || |||||||| |
|
|
| T |
25944568 |
ggtgggaccccttccctgaccctgcgtatgtgggagctttagcgcaccaggctgcccttt |
25944627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 77; E-Value: 2e-35
Query Start/End: Original strand, 137 - 264
Target Start/End: Complemental strand, 45621010 - 45620881
Alignment:
| Q |
137 |
tgaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt---aaaacagggt |
233 |
Q |
| |
|
||||||| | ||||||||| || |||||||||||||||| |||||| ||||||||||||||||||| ||| |||||||||||||||| |||||||||| |
|
|
| T |
45621010 |
tgagggggagccttggcgcaac-ggtaaagttgttgtcacgtgactgaaaggtcacgggttcaagttctggaaacagcctcttgtgtaaaaaaacagggt |
45620912 |
T |
 |
| Q |
234 |
aaggctgcgtacaatacaccaaatggtggga |
264 |
Q |
| |
|
|||||||||||||||||||||| |||||||| |
|
|
| T |
45620911 |
aaggctgcgtacaatacaccaattggtggga |
45620881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 77; E-Value: 2e-35
Query Start/End: Original strand, 177 - 305
Target Start/End: Complemental strand, 54374488 - 54374357
Alignment:
| Q |
177 |
gtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaaca--gggtaaggctgcgtacaatacaccaaa-tggtgggaccccttccc |
273 |
Q |
| |
|
|||||| ||||||||| |||||||||| || ||||| |||||||||||||| | ||||||||||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
54374488 |
gtgactgaaaggtcacaggttcaagtcttggaaacaacctcttgtgtaaaaaatagggtaaggctgcgtacaatccaccaaaatggtgggaccccttccc |
54374389 |
T |
 |
| Q |
274 |
ggaccctgcatatgcgggagctctagtgcacc |
305 |
Q |
| |
|
|||||||||||||||||||||| |||| |||| |
|
|
| T |
54374388 |
ggaccctgcatatgcgggagctttagttcacc |
54374357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 75; E-Value: 3e-34
Query Start/End: Original strand, 224 - 315
Target Start/End: Complemental strand, 353444 - 353351
Alignment:
| Q |
224 |
aaaacagggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccct |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
353444 |
aaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttgccct |
353351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 74; E-Value: 1e-33
Query Start/End: Original strand, 212 - 317
Target Start/End: Original strand, 26292382 - 26292487
Alignment:
| Q |
212 |
agcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttg |
311 |
Q |
| |
|
||||||||||||||||||||||||| | |||||| |||||||||||| ||||| ||||||||| ||||||||||||||||| |||||||||||||||||| |
|
|
| T |
26292382 |
agcctcttgtgtaaaacagggtaagaccgcgtacgatacaccaaatgatgggatcccttcccgaaccctgcatatgcgggaactctagtgcaccgggttg |
26292481 |
T |
 |
| Q |
312 |
cccttt |
317 |
Q |
| |
|
||||| |
|
|
| T |
26292482 |
tccttt |
26292487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 207 - 281
Target Start/End: Original strand, 47624087 - 47624162
Alignment:
| Q |
207 |
aaaacagcctcttgtgtaaaa-cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctg |
281 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47624087 |
aaaacagcctcttgtgtaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctg |
47624162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 66; E-Value: 6e-29
Query Start/End: Original strand, 160 - 313
Target Start/End: Complemental strand, 44403715 - 44403559
Alignment:
| Q |
160 |
ggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatac-accaaa |
256 |
Q |
| |
|
||||||||| |||||| ||| |||||||||||| |||| |||||||| || |||||||||||||||| || |||||||||||| | ||||| || ||| |
|
|
| T |
44403715 |
ggtaaagttattgtcacgtggctaaaaggtcacaggttaaagtcctgggaatagcctcttgtgtaaaagacaaggtaaggctgcggagaataccacaaaa |
44403616 |
T |
 |
| Q |
257 |
tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcc |
313 |
Q |
| |
|
|||||||||||||||||||||||| | ||||| | |||| |||||||||||| |||| |
|
|
| T |
44403615 |
tggtgggaccccttcccggaccctacgtatgctgaagctttagtgcaccgggctgcc |
44403559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 66; E-Value: 6e-29
Query Start/End: Original strand, 173 - 316
Target Start/End: Complemental strand, 45139624 - 45139479
Alignment:
| Q |
173 |
tcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaa--acagggtaaggctgcgtacaatacacc--aaatggtgggacccc |
268 |
Q |
| |
|
|||||||||| ||||||||||||||||||| || ||||| ||||||||||||| ||||||||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
45139624 |
tcatgtgactgaaaggtcacgggttcaagttttggaaacaacctcttgtgtaaaacacagggtaaggctgcatacaatacaccaaaaatggtgggacccc |
45139525 |
T |
 |
| Q |
269 |
ttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctt |
316 |
Q |
| |
|
||||| || ||||| ||||||||| || | |||||||||| ||||||| |
|
|
| T |
45139524 |
ttcccaga-cctgcgtatgcgggaact-ttgtgcaccgggctgccctt |
45139479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 160 - 313
Target Start/End: Original strand, 19731000 - 19731155
Alignment:
| Q |
160 |
ggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaat |
257 |
Q |
| |
|
|||||| ||||||||| |||| | ||||||||||| | ||||||||| ||| |||||||||||||||| || ||||||| ||||||||||||||| | | |
|
|
| T |
19731000 |
ggtaaatttgttgtcacgtgattgaaaggtcacggatgcaagtcctggaaatagcctcttgtgtaaaaaacaaggtaaggttgcgtacaatacacctatt |
19731099 |
T |
 |
| Q |
258 |
ggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcc |
313 |
Q |
| |
|
|||||||||| ||||| ||| ||| ||||| |||||| |||||||||||| |||| |
|
|
| T |
19731100 |
ggtgggaccctttcccagactctgtgtatgcaggagctttagtgcaccgggctgcc |
19731155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 173 - 317
Target Start/End: Complemental strand, 54032705 - 54032571
Alignment:
| Q |
173 |
tcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaaggctgcgtacaatacaccaaatggtgggacccctt |
270 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| ||||| |||||||||| |||||||||||||||||| ||||||||||| ||||||| |
|
|
| T |
54032705 |
tcatgtgactggaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccgaatggtg--------- |
54032615 |
T |
 |
| Q |
271 |
cccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
||||||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
54032614 |
---ggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
54032571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 137 - 317
Target Start/End: Original strand, 12525385 - 12525564
Alignment:
| Q |
137 |
tgaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||| ||||| ||||||||| ||||| ||||||| |||||||||||||||||||| ||||||| |
|
|
| T |
12525385 |
tgaggggtaaccttggcgcaactggtaaagttgt---catatgactgaaaggtcacaggttcgagtcctggaaacagcctcttgtgtaaaaatcagggta |
12525481 |
T |
 |
| Q |
235 |
aggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|||||||| | | || |||||||||||| |||||| ||||||| ||| |||||||| | |||||| |||||| |||| |
|
|
| T |
12525482 |
aggctgcgaagtacaccaaaaatggtgggacaccttcctagaccctgtgtatacgggagcttcactgcaccaggttgctcttt |
12525564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 61; E-Value: 6e-26
Query Start/End: Original strand, 211 - 320
Target Start/End: Original strand, 9276313 - 9276422
Alignment:
| Q |
211 |
cagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccggg |
308 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||| |||||||||||||| ||||||||| || || ||| | ||| |
|
|
| T |
9276313 |
cagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaatggt-ggaccctttcccggaccctgcgtatgcgggaacttta-tgcgcaggg |
9276410 |
T |
 |
| Q |
309 |
ttgccctttaat |
320 |
Q |
| |
|
|||||||||||| |
|
|
| T |
9276411 |
ttgccctttaat |
9276422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 61; E-Value: 6e-26
Query Start/End: Original strand, 257 - 317
Target Start/End: Original strand, 30452892 - 30452952
Alignment:
| Q |
257 |
tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30452892 |
tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
30452952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 61; E-Value: 6e-26
Query Start/End: Original strand, 208 - 318
Target Start/End: Original strand, 31831245 - 31831344
Alignment:
| Q |
208 |
aaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgg |
307 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| |||||||||||||||||| |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
31831245 |
aaacagcctcttgtgtaaaatagggtaaggctgcatacaatacaccaaatggt-----------ccggaccctgcatatgcgggtgctctagtgcaccgg |
31831333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 61; E-Value: 6e-26
Query Start/End: Original strand, 158 - 316
Target Start/End: Original strand, 33235526 - 33235687
Alignment:
| Q |
158 |
ctggtaaagttgttgtcatgtgac-taaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa---cagggtaaggctgcgtacaatacacc |
253 |
Q |
| |
|
|||||||||||||||||||||||| | ||||||||| |||||| || || ||| |||||||||||||||| ||||||||| ||| ||||||||||| |
|
|
| T |
33235526 |
ctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaagagcctcttgtgtaaaaaaacagggtaagactgtgtacaatacact |
33235625 |
T |
 |
| Q |
254 |
aaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctt |
316 |
Q |
| |
|
||||||||||||||| || | |||| | | ||||||| |||| ||||||||| |||||||||| |
|
|
| T |
33235626 |
aaatggtgggacccc-tcgcagaccttacgtatgcggaagctttagtgcaccaggttgccctt |
33235687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 168 - 295
Target Start/End: Complemental strand, 8411016 - 8410889
Alignment:
| Q |
168 |
tgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccc |
267 |
Q |
| |
|
|||||||||| |||| ||||||||| |||||| |||||| |||| ||||| ||| |||||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
8411016 |
tgttgtcatgggactgaaaggtcaccggttcaggtcctggaaactgcctcgtgtaaaaaacagggtaaggctgctcacaatacaccaactggtgggacct |
8410917 |
T |
 |
| Q |
268 |
cttcccggaccctgcatatgcgggagct |
295 |
Q |
| |
|
|||| | ||||||||||| |||| |||| |
|
|
| T |
8410916 |
cttctcagaccctgcataggcggaagct |
8410889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #54
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 251 - 317
Target Start/End: Complemental strand, 24851367 - 24851301
Alignment:
| Q |
251 |
accaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
24851367 |
accaaatggtgggaccccttcccggatcctgcatatgcgggagctttagtgcaccgggttgcccttt |
24851301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #55
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 181 - 318
Target Start/End: Original strand, 55401195 - 55401335
Alignment:
| Q |
181 |
ctaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaaggctgcgtacaatacacc-aaatggtgggaccccttcccggac |
277 |
Q |
| |
|
|||||||| || ||||||||||||| |||||||||||||||| |||||||| |||| ||||||| |||||||| |||||||||||||||||| ||||| |
|
|
| T |
55401195 |
ctaaaaggccatcggttcaagtcctgtaaacagcctcttgtgtaaaaaacaggttaagactgcgtataatacaccaaaatggtgggaccccttctcggac |
55401294 |
T |
 |
| Q |
278 |
cctgcatatgcgggagctctagtgcaccgggttgcccttta |
318 |
Q |
| |
|
| | | |||||||||||| | ||||||||| |||| |||| |
|
|
| T |
55401295 |
cttccgtatgcgggagcttttttgcaccgggctgcctttta |
55401335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #56
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 160 - 318
Target Start/End: Original strand, 28904941 - 28905101
Alignment:
| Q |
160 |
ggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaa---aacagggtaaggctgcgtacaatacaccaaa |
256 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| ||| |||||| | ||||| ||||||||||| |||| |||||| ||| ||||| ||||||||| |
|
|
| T |
28904941 |
ggtaaagttgttgtcatgtgactaaaaagtcacatgtttaagtccagggaacagtctcttgtgtaaaataacaaggtaagactgtgtacattacaccaaa |
28905040 |
T |
 |
| Q |
257 |
tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttta |
318 |
Q |
| |
|
| |||||||| |||||||||||||| || |||||| || ||||| | |||| ||||||||| |
|
|
| T |
28905041 |
t-atgggaccctttcccggaccctgcgtaagcgggaactttagtgtaacgggctgcccttta |
28905101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #57
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 160 - 313
Target Start/End: Original strand, 19751576 - 19751731
Alignment:
| Q |
160 |
ggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaat |
257 |
Q |
| |
|
|||||| || |||||| |||| | ||||||||||| | ||||||||| ||| |||||||||||||||| || ||||||| ||||||||||||||| | | |
|
|
| T |
19751576 |
ggtaaattttttgtcacgtgattgaaaggtcacggatgcaagtcctggaaatagcctcttgtgtaaaaatcaaggtaaggttgcgtacaatacacctatt |
19751675 |
T |
 |
| Q |
258 |
ggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcc |
313 |
Q |
| |
|
|||||||||| ||||| ||| || ||||| ||||| |||||||||||| |||| |
|
|
| T |
19751676 |
ggtgggaccctttcccagactttgtgtatgcatgagctttagtgcaccgggctgcc |
19751731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #58
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 242 - 317
Target Start/End: Original strand, 24577917 - 24577992
Alignment:
| Q |
242 |
gtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
||||||||||| ||||||||||| || ||||| |||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
24577917 |
gtacaatacactaaatggtgggatcctttcccagaccctgcatatacgggagctctagtgcaccggattgcccttt |
24577992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #59
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 242 - 317
Target Start/End: Original strand, 24578007 - 24578082
Alignment:
| Q |
242 |
gtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
||||||||||| |||||||||||| | ||||| |||||| ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
24578007 |
gtacaatacactaaatggtgggactctttcccagaccctacatatgcgggaactctagtgcaccgggttgcccttt |
24578082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #60
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 195 - 303
Target Start/End: Complemental strand, 43114994 - 43114882
Alignment:
| Q |
195 |
gttcaagtcctgaaaacagcctcttgtgt---aaaacagggtaa-ggctgcgtacaatacaccaaatggtgggaccccttcccgga-ccctgcatatgcg |
289 |
Q |
| |
|
|||||||||||| |||||||||||||||| |||||||||||| |||| | |||||||||||||||||||||| ||||||| ||| |||||| |||||| |
|
|
| T |
43114994 |
gttcaagtcctggaaacagcctcttgtgtaaaaaaacagggtaagggctacctacaatacaccaaatggtggga-cccttcctggacccctgcgtatgcg |
43114896 |
T |
 |
| Q |
290 |
ggagctctagtgca |
303 |
Q |
| |
|
|||||| ||||||| |
|
|
| T |
43114895 |
ggagctttagtgca |
43114882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #61
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 184 - 308
Target Start/End: Complemental strand, 52428613 - 52428479
Alignment:
| Q |
184 |
aaaggtcacgggttcaagtc-ctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgg-------gaccccttccc |
273 |
Q |
| |
|
|||||||||||||| ||||| ||| || ||||||||||||||||| |||||||||||||||||||||||||||||| |||| |||||||| | |
|
|
| T |
52428613 |
aaaggtcacgggtttaagtctctggaagcagcctcttgtgtaaaatacagggtaaggctgcgtacaatacaccaaatagtggaaccccaaaccccttctc |
52428514 |
T |
 |
| Q |
274 |
ggaccctgcatatgcgggagctctagtgcaccggg |
308 |
Q |
| |
|
||||||| | |||| ||||||| |||||||||||| |
|
|
| T |
52428513 |
ggaccctacgtatgtgggagctttagtgcaccggg |
52428479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #62
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 160 - 234
Target Start/End: Original strand, 53062036 - 53062112
Alignment:
| Q |
160 |
ggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggta |
234 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |||||||||||| |||||||||| ||||| ||||||||||| |
|
|
| T |
53062036 |
ggtaaagttgttgtcatgtgactgaaaggtcacgtgttcaagtcctggaaacagcctcctgtgtcaaaaacagggta |
53062112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #63
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 208 - 317
Target Start/End: Complemental strand, 50625064 - 50624953
Alignment:
| Q |
208 |
aaacagcctcttgtgta--aaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcacc |
305 |
Q |
| |
|
||||||||||||||||| ||| ||||||||| ||||||||||||||| ||||||||| |||||| || |||||| || | ||||||| ||||||||| |
|
|
| T |
50625064 |
aaacagcctcttgtgtataaaaaagggtaaggtagcgtacaatacaccatttggtgggacgccttcctgggccctgcgtaagtgggagctttagtgcacc |
50624965 |
T |
 |
| Q |
306 |
gggttgcccttt |
317 |
Q |
| |
|
||| |||||||| |
|
|
| T |
50624964 |
gggctgcccttt |
50624953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #64
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 160 - 307
Target Start/End: Complemental strand, 829601 - 829452
Alignment:
| Q |
160 |
ggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaa--acagggtaaggctgcgtacaatacaccaaa- |
256 |
Q |
| |
|
|||||||||||||||| |||| | |||| | || |||||||| || ||||| |||||||| |||| ||| |||| | |||||||||||||||||| |
|
|
| T |
829601 |
ggtaaagttgttgtcacgtgattgaaagacc-cgagttcaagttctagaaacaacctcttgtctaaagaacatagtaaagttgcgtacaatacaccaaaa |
829503 |
T |
 |
| Q |
257 |
tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgg |
307 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||| |||||| ||||||||||| |
|
|
| T |
829502 |
tggtgggaccccttcccgaaccctgcgtatgcaggagctttagtgcaccgg |
829452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #65
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 168 - 270
Target Start/End: Original strand, 29106555 - 29106659
Alignment:
| Q |
168 |
tgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaaggctgcgtacaatacaccaaatggtgggac |
265 |
Q |
| |
|
|||||||||||| || |||| |||||||| |||||| |||||||| |||||||||| |||| ||| ||||| | ||||||||||||||||| |||||| |
|
|
| T |
29106555 |
tgttgtcatgtggctcaaagatcacgggtacaagtcttgaaaacaacctcttgtgtaaaaaataggataaggttacgtacaatacaccaaattgtgggat |
29106654 |
T |
 |
| Q |
266 |
ccctt |
270 |
Q |
| |
|
||||| |
|
|
| T |
29106655 |
ccctt |
29106659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #66
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 262 - 322
Target Start/End: Complemental strand, 10484671 - 10484611
Alignment:
| Q |
262 |
ggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttaatgt |
322 |
Q |
| |
|
||||||||||| ||||||||| |||||||||||| ||||||||||||||||||||| |||| |
|
|
| T |
10484671 |
ggaccccttcctggaccctgcgtatgcgggagctttagtgcaccgggttgcccttttatgt |
10484611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #67
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 147 - 314
Target Start/End: Original strand, 35417902 - 35418058
Alignment:
| Q |
147 |
ccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgta |
244 |
Q |
| |
|
||||||||| || |||||||||||| |||||||||| | |||||||| |||||| ||||| |||||||||||||||||||| ||||| ||| | || |
|
|
| T |
35417902 |
ccttggcgcaac-ggtaaagttgttatcatgtgactgagaggtcacgagttcaaatcctggaaacagcctcttgtgtaaaaaacaggg-aagaccgc--- |
35417996 |
T |
 |
| Q |
245 |
caatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccc |
314 |
Q |
| |
|
||||||||||||||||||||||||||| ||| ||||| ||||| ||||||| |||| ||||| |
|
|
| T |
35417997 |
--------caaatggtgggaccccttcccggaccccgcaaatgcgagagctttagtgcatcgggctgccc |
35418058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #68
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 141 - 257
Target Start/End: Original strand, 21874999 - 21875111
Alignment:
| Q |
141 |
gggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt---aaaacagggtaagg |
237 |
Q |
| |
|
||||||||||| ||| ||||||||||||||||||||||||| | |||||||||| | ||| ||||| |||||||||| |||| ||||||||| |
|
|
| T |
21874999 |
gggtaaccttgacgcaactggtaaagttgttgtcatgtgac-------tgacgggttcaaattctggaaacaacctcttgtgttaaaaaagagggtaagg |
21875091 |
T |
 |
| Q |
238 |
ctgcgtacaatacaccaaat |
257 |
Q |
| |
|
||||||||||||||| |||| |
|
|
| T |
21875092 |
ctgcgtacaatacactaaat |
21875111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #69
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 201 - 316
Target Start/End: Complemental strand, 31904975 - 31904857
Alignment:
| Q |
201 |
gtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtggga-ccccttcccggaccctgcatatgcgggagctct |
297 |
Q |
| |
|
|||||| ||||||||| || ||||||| ||||||| | ||||||||||||||||||||||||||| ||||||||| || | | | | |||||||||| | |
|
|
| T |
31904975 |
gtcctggaaacagcctattatgtaaaaaacagggtatgactgcgtacaatacaccaaatggtgggacccccttcccagatcttacgtgtgcgggagcttt |
31904876 |
T |
 |
| Q |
298 |
agtgcaccgggttgccctt |
316 |
Q |
| |
|
|||||||| || ||||||| |
|
|
| T |
31904875 |
agtgcaccaggctgccctt |
31904857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #70
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 271 - 317
Target Start/End: Complemental strand, 6242331 - 6242285
Alignment:
| Q |
271 |
cccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
6242331 |
cccggaccctgcatatgcaggagctctagtgcaccgggttgcccttt |
6242285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #71
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 164 - 251
Target Start/End: Original strand, 39211992 - 39212081
Alignment:
| Q |
164 |
aagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaa--aacagggtaaggctgcgtacaataca |
251 |
Q |
| |
|
||||||| || |||||||| ||| ||||||||||||||||||| ||| | |||||||||||| |||| |||||| |||||||||||||| |
|
|
| T |
39211992 |
aagttgtcgttatgtgactgaaatgtcacgggttcaagtcctggaaataacctcttgtgtaaataacaaggtaagactgcgtacaataca |
39212081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #72
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 141 - 258
Target Start/End: Original strand, 26782345 - 26782464
Alignment:
| Q |
141 |
gggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaaggc |
238 |
Q |
| |
|
||||||||||| ||| | |||||||||| |||||||| || | ||||||||||| |||||||||| ||||| ||||||||| |||| ||||||| || |
|
|
| T |
26782345 |
gggtaaccttgacgcaattggtaaagttattgtcatgcgattgaaaggtcacggattcaagtccttgaaacaatctcttgtgtaaaaaatagggtaatgc |
26782444 |
T |
 |
| Q |
239 |
tgcgtacaatacaccaaatg |
258 |
Q |
| |
|
|| || ||||||||||||| |
|
|
| T |
26782445 |
tgtataaaatacaccaaatg |
26782464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #73
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 269 - 317
Target Start/End: Original strand, 47624208 - 47624256
Alignment:
| Q |
269 |
ttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|||||||||||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
47624208 |
ttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
47624256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #74
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 246 - 295
Target Start/End: Complemental strand, 46170038 - 46169989
Alignment:
| Q |
246 |
aatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagct |
295 |
Q |
| |
|
|||| |||||||||| |||||||||||||||||||||||||| ||||||| |
|
|
| T |
46170038 |
aataaaccaaatggtaggaccccttcccggaccctgcatatgtgggagct |
46169989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #75
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 276 - 317
Target Start/End: Original strand, 40390357 - 40390398
Alignment:
| Q |
276 |
accctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
||||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
40390357 |
accctgcgtatgcgggagctttagtgcaccgggttgcccttt |
40390398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #76
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 137 - 177
Target Start/End: Original strand, 9276249 - 9276289
Alignment:
| Q |
137 |
tgaggggtaaccttggcgccactggtaaagttgttgtcatg |
177 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
9276249 |
tgaggggtaaccttggcgcaactagtaaagttgttgtcatg |
9276289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #77
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 257 - 317
Target Start/End: Complemental strand, 14266431 - 14266372
Alignment:
| Q |
257 |
tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
||||||||||| |||| | ||||||| |||||||||||| |||||||| |||||||||||| |
|
|
| T |
14266431 |
tggtgggaccc-ttcctgaaccctgcgtatgcgggagctttagtgcactgggttgcccttt |
14266372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #78
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 138 - 267
Target Start/End: Complemental strand, 43956640 - 43956510
Alignment:
| Q |
138 |
gaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaa |
235 |
Q |
| |
|
|||||| ||||||||||| || |||||||||||||| | ||||| ||| ||| ||||||| || ||| |||||||||| ||||| |||| | || |
|
|
| T |
43956640 |
gagggggaaccttggcgcaac-ggtaaagttgttgttacttgactgaaaagtccggggttcatgttctggaaacagcctcatgtgtaaaaaaaaacacaa |
43956542 |
T |
 |
| Q |
236 |
ggctgcgtacaatacaccaaatggtgggaccc |
267 |
Q |
| |
|
|||| || |||||||||||||||||||||||| |
|
|
| T |
43956541 |
ggctacgcacaatacaccaaatggtgggaccc |
43956510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #79
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 254 - 317
Target Start/End: Original strand, 40968612 - 40968675
Alignment:
| Q |
254 |
aaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|||||||| |||||||||| |||||| |||||||||||||| ||||||| || | |||||||| |
|
|
| T |
40968612 |
aaatggtgagaccccttcctagaccctacatatgcgggagctttagtgcatcgagctgcccttt |
40968675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #80
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 224 - 290
Target Start/End: Complemental strand, 21330339 - 21330273
Alignment:
| Q |
224 |
aaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgg |
290 |
Q |
| |
|
|||| |||||||||| || ||||||||||||||| | ||||||| |||| |||| ||||||||||| |
|
|
| T |
21330339 |
aaaatagggtaaggccgcatacaatacaccaaattgcgggaccctttcctagaccatgcatatgcgg |
21330273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #81
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 162 - 256
Target Start/End: Complemental strand, 1121382 - 1121286
Alignment:
| Q |
162 |
taaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaa--aacagggtaaggctgcgtacaatacaccaaa |
256 |
Q |
| |
|
|||| |||||||| ||| || |||||||||| ||| |||||||| ||||| | |||||||||| || | ||| || ||||||||||||||||||| |
|
|
| T |
1121382 |
taaatttgttgtccggtggctgaaaggtcacgtgtttaagtcctggaaacaacttcttgtgtaagaaataaggtgagactgcgtacaatacaccaaa |
1121286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #82
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 141 - 178
Target Start/End: Original strand, 23871418 - 23871455
Alignment:
| Q |
141 |
gggtaaccttggcgccactggtaaagttgttgtcatgt |
178 |
Q |
| |
|
||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
23871418 |
gggtaaccttggcgcaactagtaaagttgttgtcatgt |
23871455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #83
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 138 - 186
Target Start/End: Original strand, 39430465 - 39430513
Alignment:
| Q |
138 |
gaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaa |
186 |
Q |
| |
|
|||||||||| ||| ||| ||||||||||||| |||||| ||||||||| |
|
|
| T |
39430465 |
gaggggtaactttgacgcaactggtaaagttgctgtcatctgactaaaa |
39430513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #84
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 160 - 188
Target Start/End: Original strand, 55400996 - 55401024
Alignment:
| Q |
160 |
ggtaaagttgttgtcatgtgactaaaagg |
188 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
55400996 |
ggtaaagttgttgtcatgtgactaaaagg |
55401024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 166; Significance: 1e-88; HSPs: 105)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 166; E-Value: 1e-88
Query Start/End: Original strand, 136 - 317
Target Start/End: Complemental strand, 34725279 - 34725098
Alignment:
| Q |
136 |
ctgaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaa |
235 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
34725279 |
ctgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaacagggtaa |
34725180 |
T |
 |
| Q |
236 |
ggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34725179 |
ggctgcgtacaatacactaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
34725098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 148; E-Value: 7e-78
Query Start/End: Original strand, 138 - 317
Target Start/End: Complemental strand, 38478461 - 38478282
Alignment:
| Q |
138 |
gaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaagg |
237 |
Q |
| |
|
|||||||||||||||||| ||| ||||| |||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
38478461 |
gaggggtaaccttggcgcaactagtaaacttgttgtcatgtgactgaaaggtcacgggttcaagtcctagaaacagcctcttgtgtaaaacagggtaagg |
38478362 |
T |
 |
| Q |
238 |
ctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38478361 |
ctgcgtacaatacaccaaatggtggaaccccttctcggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
38478282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 140; E-Value: 4e-73
Query Start/End: Original strand, 138 - 313
Target Start/End: Complemental strand, 45812716 - 45812541
Alignment:
| Q |
138 |
gaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaagg |
237 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||||||||||||| ||||||||| |||||||||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
45812716 |
gaggggtaaccttggcgcaactgataaagttgttgtcatgtgactgaaaggtcacaggttcaagtcctgaaaacagtctcttgtgtaaaagagggtaagg |
45812617 |
T |
 |
| Q |
238 |
ctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcc |
313 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45812616 |
ctgcatacaatacaccaaatggtgggaccccttcccaaaccctgcatatgcgggagctctagtgcaccgggttgcc |
45812541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 136; E-Value: 1e-70
Query Start/End: Original strand, 138 - 305
Target Start/End: Original strand, 47214488 - 47214655
Alignment:
| Q |
138 |
gaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaagg |
237 |
Q |
| |
|
|||||||||| ||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||| |||||| ||||||| ||||||||||||||| |
|
|
| T |
47214488 |
gaggggtaactttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagtctcttgtttaaaacagggtaagg |
47214587 |
T |
 |
| Q |
238 |
ctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcacc |
305 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
47214588 |
ttgcgtacaatacaccaaatggtgggaccccttcccagaccctgcatatgcgggagctctagtgcacc |
47214655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 133; E-Value: 7e-69
Query Start/End: Original strand, 138 - 317
Target Start/End: Complemental strand, 32632737 - 32632557
Alignment:
| Q |
138 |
gaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt-aaaacagggtaag |
236 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||| ||||| ||||||||||||||||||||||| |||||||||||||||| ||||||||||||| |
|
|
| T |
32632737 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatatgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaacagggtaag |
32632638 |
T |
 |
| Q |
237 |
gctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||| |||| |||||| |
|
|
| T |
32632637 |
gctgcgtacaatacaccaaatggtgggaccccttcccaaaccctgcatatgcgggagcttgagtgcaccaggtttcccttt |
32632557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 132; E-Value: 3e-68
Query Start/End: Original strand, 137 - 317
Target Start/End: Original strand, 14617014 - 14617196
Alignment:
| Q |
137 |
tgaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaa--acagggta |
234 |
Q |
| |
|
||||||||||||||||||| || ||||||||||||||||||||||| |||||||||| |||||||||||| ||||||||||||||||||| ||| |||| |
|
|
| T |
14617014 |
tgaggggtaaccttggcgcaaccggtaaagttgttgtcatgtgactgaaaggtcacgagttcaagtcctggaaacagcctcttgtgtaaataacaaggta |
14617113 |
T |
 |
| Q |
235 |
aggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
14617114 |
aggttgcgtacaatacaccaaatggtgggatcccttcccggaccctgcatatgcgggagctttagtgcaccgggttacccttt |
14617196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 132; E-Value: 3e-68
Query Start/End: Original strand, 142 - 317
Target Start/End: Original strand, 19414420 - 19414595
Alignment:
| Q |
142 |
ggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaaggctgc |
241 |
Q |
| |
|
||||||||||||| | |||||||||||||||||| ||||| |||||||||||||||||||||| ||| |||||||| ||||||||||| ||||||||| |
|
|
| T |
19414420 |
ggtaaccttggcgtaattggtaaagttgttgtcatatgactgaaaggtcacgggttcaagtcctagaaagagcctcttatgtaaaacaggttaaggctgc |
19414519 |
T |
 |
| Q |
242 |
gtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19414520 |
gtacaatacaccaaatggtgggaccccttcccgtaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
19414595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 131; E-Value: 1e-67
Query Start/End: Original strand, 138 - 317
Target Start/End: Complemental strand, 46248134 - 46247953
Alignment:
| Q |
138 |
gaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaa |
235 |
Q |
| |
|
|||||||||||||||| | |||||||||||||||||||||||||| ||| |||||||||||||||| || |||||||||||||||||||| |||||||| |
|
|
| T |
46248134 |
gaggggtaaccttggctcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaagtcttggaaacagcctcttgtgtaaaaaacagggtaa |
46248035 |
T |
 |
| Q |
236 |
ggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||| ||||||||||||||| |
|
|
| T |
46248034 |
gactgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgtaccgggttgcccttt |
46247953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 128; E-Value: 6e-66
Query Start/End: Original strand, 144 - 317
Target Start/End: Complemental strand, 30395903 - 30395726
Alignment:
| Q |
144 |
taaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaaggctgc |
241 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||| |||||||||||||||||| |
|
|
| T |
30395903 |
taaccttggcgcaactggtaaagttgttgtcatgtgactttaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggctgc |
30395804 |
T |
 |
| Q |
242 |
gtacaatacacca--aatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||| ||||||||||||||| |||||||||| |||||||||| |
|
|
| T |
30395803 |
gtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgagttgcccttt |
30395726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 127; E-Value: 3e-65
Query Start/End: Original strand, 138 - 317
Target Start/End: Original strand, 18944620 - 18944804
Alignment:
| Q |
138 |
gaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaa |
235 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||| ||||||||| |||||||| |||| |||||||||||||||| |||||||||||| |
|
|
| T |
18944620 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacaggttcaaggcctggaaacagcctcttgtgtaaaaaacagggtaa |
18944719 |
T |
 |
| Q |
236 |
ggctgcgtacaatacacca--aatggtgggaccccttcccggaccctgcatatgcgggagc-tctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||| | ||||||||||||||||||||| |
|
|
| T |
18944720 |
ggctgcgtacaatacaccaacaatggtgggaccccttcccggaccctgcgtatgcgggagcttttagtgcaccgggttgcccttt |
18944804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 124; E-Value: 2e-63
Query Start/End: Original strand, 138 - 314
Target Start/End: Original strand, 46991781 - 46991959
Alignment:
| Q |
138 |
gaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaa |
235 |
Q |
| |
|
||||||||||||||| || |||||||||||||||||||||||||| |||||||||||||||||||||| ||||| |||||||||||||| |||||||| |
|
|
| T |
46991781 |
gaggggtaaccttggtgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaaaacagggtaa |
46991880 |
T |
 |
| Q |
236 |
ggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccc |
314 |
Q |
| |
|
||||| |||||||||||| |||||||||||||||||||||||||||| |||| ||||||| |||||||||||||||||| |
|
|
| T |
46991881 |
ggctgtgtacaatacaccgaatggtgggaccccttcccggaccctgcgtatgtgggagctttagtgcaccgggttgccc |
46991959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 123; E-Value: 6e-63
Query Start/End: Original strand, 175 - 317
Target Start/End: Complemental strand, 35253329 - 35253187
Alignment:
| Q |
175 |
atgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccg |
274 |
Q |
| |
|
|||||||| |||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35253329 |
atgtgactgaaagatcacgggttcaagtcctcgaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccg |
35253230 |
T |
 |
| Q |
275 |
gaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
35253229 |
gaccctgcatatgcgggagctctagtgcaccggattgcccttt |
35253187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 122; E-Value: 2e-62
Query Start/End: Original strand, 144 - 317
Target Start/End: Complemental strand, 12127010 - 12126837
Alignment:
| Q |
144 |
taaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaaggctgcgt |
243 |
Q |
| |
|
|||||||||||| ||| |||||||||||||||||| | | |||||||||||||| |||| ||| ||||||| |||||||||||||||||||||||||||| |
|
|
| T |
12127010 |
taaccttggcgcaactcgtaaagttgttgtcatgtaattgaaaggtcacgggtttaagttctggaaacagcttcttgtgtaaaacagggtaaggctgcgt |
12126911 |
T |
 |
| Q |
244 |
acaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||| | |||||||||| |
|
|
| T |
12126910 |
acaatacaccaaattgtgggaccccttcccggaccctgcatatgcgggagctgtagtgcactgcgttgcccttt |
12126837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 122; E-Value: 2e-62
Query Start/End: Original strand, 138 - 317
Target Start/End: Complemental strand, 20004273 - 20004090
Alignment:
| Q |
138 |
gaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaa |
235 |
Q |
| |
|
||||||||||||||| || |||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||| |||| |||||| ||||| |
|
|
| T |
20004273 |
gaggggtaaccttggtgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagcctctcgtgtaaaaaacaaggtaa |
20004174 |
T |
 |
| Q |
236 |
ggctgcgtacaatacacca--aatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
20004173 |
ggctgcgtacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttt |
20004090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 115; E-Value: 4e-58
Query Start/End: Original strand, 138 - 317
Target Start/End: Original strand, 10668197 - 10668385
Alignment:
| Q |
138 |
gaggggtaaccttggcgccactggtaaagttgttgtcatgtga-----ctaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cag |
230 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||| || ||||||||||||||||||||||| |||||||||||||||||||| || |
|
|
| T |
10668197 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacaa |
10668296 |
T |
 |
| Q |
231 |
ggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
||||||| ||||||||||||||||| |||||||||||||||||||| |||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
10668297 |
ggtaaggttgcgtacaatacaccaataatggtgggaccccttcccggtccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
10668385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 114; E-Value: 1e-57
Query Start/End: Original strand, 137 - 317
Target Start/End: Original strand, 27474257 - 27474438
Alignment:
| Q |
137 |
tgaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa-cagggtaa |
235 |
Q |
| |
|
|||||||||||||| || | |||||||||||||||||||||||||| ||||||||| |||||||||| || |||||| ||||||||||||| ||||| || |
|
|
| T |
27474257 |
tgaggggtaaccttagctcaactggtaaagttgttgtcatgtgactgaaaggtcacaggttcaagtcttggaaacagtctcttgtgtaaaaacagggcaa |
27474356 |
T |
 |
| Q |
236 |
ggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||| |||||||||||| ||||||||||| ||||||||| |
|
|
| T |
27474357 |
agctgcgtacaatacactgaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccggattgcccttt |
27474438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 112; E-Value: 2e-56
Query Start/End: Original strand, 137 - 317
Target Start/End: Complemental strand, 41319988 - 41319806
Alignment:
| Q |
137 |
tgaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggta |
234 |
Q |
| |
|
||||||||||||||| | | |||||||||||||||||||||||||| ||||||||| |||| |||||||| |||||| ||||||||||||| ||||||| |
|
|
| T |
41319988 |
tgaggggtaaccttgacacaactggtaaagttgttgtcatgtgactgaaaggtcacaggtttaagtcctggaaacagtctcttgtgtaaaaaacagggta |
41319889 |
T |
 |
| Q |
235 |
aggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||| ||||| |||||||||||| | ||||||| |||||||||||| |
|
|
| T |
41319888 |
aggctgcgtacaatacaccaaatgatgggaccccttcccgaacccttcatatgcgggagtttcagtgcactgggttgcccttt |
41319806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 111; E-Value: 9e-56
Query Start/End: Original strand, 137 - 317
Target Start/End: Original strand, 27201623 - 27201807
Alignment:
| Q |
137 |
tgaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggta |
234 |
Q |
| |
|
|||||||||||||| ||| | |||||||||||||||||||||||| |||||||| |||||||||||||| |||||||||||||||| |||||||||| |
|
|
| T |
27201623 |
tgaggggtaaccttagcgtaaatggtaaagttgttgtcatgtgactgaaaggtcatgggttcaagtcctggaaacagcctcttgtgtcagaaacagggta |
27201722 |
T |
 |
| Q |
235 |
aggctgcgtacaatacacc--aaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||| ||| |||||||||||| ||||||| |||||||||||| |
|
|
| T |
27201723 |
aggctgcgtacaatacaccaaaaatggtgggaccccttcccggaccttgcgtatgcgggagctttagtgcattgggttgcccttt |
27201807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 107; E-Value: 2e-53
Query Start/End: Original strand, 141 - 312
Target Start/End: Complemental strand, 23768498 - 23768325
Alignment:
| Q |
141 |
gggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggc |
238 |
Q |
| |
|
||||||||| | ||| |||||||||||||||||||||||||| |||||||| |||||||||| || |||||||||||||||||||| ||||||||||| |
|
|
| T |
23768498 |
gggtaacctcgacgcaactggtaaagttgttgtcatgtgactgtaaggtcacaggttcaagtcatggaaacagcctcttgtgtaaaaaacagggtaaggc |
23768399 |
T |
 |
| Q |
239 |
tgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgc |
312 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| |||||||| |||||||||||| ||||||| ||| |||| |
|
|
| T |
23768398 |
tgcgtacaatacaccaaatggtgggacaccttcccagaccctgcgtatgcgggagctttagtgcagcggattgc |
23768325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 105; E-Value: 3e-52
Query Start/End: Original strand, 143 - 314
Target Start/End: Original strand, 45402077 - 45402251
Alignment:
| Q |
143 |
gtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa-cagggt--aagg-c |
238 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| | ||||| |||||||||||||||| |||||||||||||||||||| |||||| ||| | |
|
|
| T |
45402077 |
gtaaccttggcgcaactggtaaagttgttgtcatgtga-tggaaggtaacgggttcaagtcctggaaacagcctcttgtgtaaaaacagggttcaagttc |
45402175 |
T |
 |
| Q |
239 |
tgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccc |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
45402176 |
tgcgtacaatacaccaaatggtgggaccccttcccagaccctgcgtatgcgggagctttagtgcaccgggttgccc |
45402251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 104; E-Value: 1e-51
Query Start/End: Original strand, 157 - 313
Target Start/End: Original strand, 6925096 - 6925254
Alignment:
| Q |
157 |
actggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaaca--gggtaaggctgcgtacaatacacca |
254 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||| ||| |||||||||||||||| | ||||||||||||| |||||||||| |
|
|
| T |
6925096 |
actggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaatagcctcttgtgtaaaaaatagggtaaggctgcggacaatacaccg |
6925195 |
T |
 |
| Q |
255 |
aatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcc |
313 |
Q |
| |
|
||||||||||||||||||||| |||||| |||||||||||| |||||||||| |||||| |
|
|
| T |
6925196 |
aatggtgggaccccttcccggtccctgcgtatgcgggagctttagtgcaccgagttgcc |
6925254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 103; E-Value: 5e-51
Query Start/End: Original strand, 160 - 295
Target Start/End: Complemental strand, 18724704 - 18724567
Alignment:
| Q |
160 |
ggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaaggctgcgtacaatacaccaaat |
257 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||| |||||||||||||||| |
|
|
| T |
18724704 |
ggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggctgtgtacaatacaccaaat |
18724605 |
T |
 |
| Q |
258 |
ggtgggaccccttcccggaccctgcatatgcgggagct |
295 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |
|
|
| T |
18724604 |
cttgggaccccttcccggaccctacatatgcgggagct |
18724567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 100; E-Value: 3e-49
Query Start/End: Original strand, 137 - 317
Target Start/End: Original strand, 8197019 - 8197201
Alignment:
| Q |
137 |
tgaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggta |
234 |
Q |
| |
|
|||||||||||||||| || |||||| ||||||||||||||||||| ||||||||||||||||||||||| || ||||||||||| |||||| |||| |
|
|
| T |
8197019 |
tgaggggtaaccttggtgcaactggtcaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggtaattgcctcttgtgtaaaaaacatggta |
8197118 |
T |
 |
| Q |
235 |
aggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
||||| |||||| ||||||||||||| |||||||||| |||||||||| |||| |||||| ||||| ||||||||||||||| |
|
|
| T |
8197119 |
aggctacgtacagtacaccaaatggtaggaccccttctcggaccctgcgtatgttggagctttagtgtaccgggttgcccttt |
8197201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 99; E-Value: 1e-48
Query Start/End: Original strand, 177 - 317
Target Start/End: Original strand, 35005139 - 35005283
Alignment:
| Q |
177 |
gtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaa--tggtgggaccccttcc |
272 |
Q |
| |
|
|||||| |||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
35005139 |
gtgactgaaaggtcacgggttcaagtcttgaaaacagcctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaaaaatggtgggaccccttcc |
35005238 |
T |
 |
| Q |
273 |
cggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|||||||||| |||||||| ||| ||||||||||||||||||||| |
|
|
| T |
35005239 |
cggaccctgcgtatgcgggcgctttagtgcaccgggttgcccttt |
35005283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 98; E-Value: 5e-48
Query Start/End: Original strand, 138 - 282
Target Start/End: Complemental strand, 22930248 - 22930104
Alignment:
| Q |
138 |
gaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt-aaaacagggtaag |
236 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||| |||||||| |||||||||||||| ||||||||| |||||| ||||||||||||| |
|
|
| T |
22930248 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcatgggttcaagtcctggaaacagccttttgtgtaaaaacagggtaag |
22930149 |
T |
 |
| Q |
237 |
gctgcgtacaatacaccaaatggtgggaccccttcccggaccctgc |
282 |
Q |
| |
|
| || | ||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
22930148 |
gttgtg-acaatacaccaaatggtgggaccccttcctggaccctgc |
22930104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 92; E-Value: 2e-44
Query Start/End: Original strand, 143 - 317
Target Start/End: Complemental strand, 18742137 - 18741957
Alignment:
| Q |
143 |
gtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcct-gaaaacagcctcttgtgt---aaaacagggtaaggc |
238 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||| |||||||| |||||||| || | | |||||| || |||| | ||||||||||||||| |
|
|
| T |
18742137 |
gtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcaagggttcaaatcttgggaaacagtcttttgtataaaaaaacagggtaaggc |
18742038 |
T |
 |
| Q |
239 |
tgcgtacaatacacc--aaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| |||||||| |||||| ||||| |||||||||||||| |||||| |
|
|
| T |
18742037 |
tgcgtacaatacaccaaaaatggtgggaccccttcccagaccctgcgtatgcgagagctttagtgcaccgggtttcccttt |
18741957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 91; E-Value: 8e-44
Query Start/End: Original strand, 159 - 317
Target Start/End: Complemental strand, 6983969 - 6983811
Alignment:
| Q |
159 |
tggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatg |
258 |
Q |
| |
|
||||||||||||||||| |||||| ||||||||| ||||||||||||| |||||||||| | | ||||||||||||| |||||||||||||||||||| |
|
|
| T |
6983969 |
tggtaaagttgttgtcacgtgactgaaaggtcacaggttcaagtcctggaaacagcctcgtataaaaaacagggtaagtatgcgtacaatacaccaaatg |
6983870 |
T |
 |
| Q |
259 |
gtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|||||||||||| ||||||||||| || || |||||| | |||||||||| |||||||| |
|
|
| T |
6983869 |
gtgggacccctttccggaccctgcgtaggcaggagctttggtgcaccgggctgcccttt |
6983811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 89; E-Value: 1e-42
Query Start/End: Original strand, 160 - 295
Target Start/End: Original strand, 11596512 - 11596648
Alignment:
| Q |
160 |
ggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa-cagggtaaggctgcgtacaatacaccaaatg |
258 |
Q |
| |
|
|||||||| | |||||||||||| ||| |||||||||||||||||| ||||| |||||||||||||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
11596512 |
ggtaaagtggctgtcatgtgactgaaatgtcacgggttcaagtcctagaaacaacctcttgtgtaaaaacagggtaaggctgcgtataatacaccaaatg |
11596611 |
T |
 |
| Q |
259 |
gtgggaccccttcccggaccctgcatatgcgggagct |
295 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
11596612 |
gtgggaccccttcctggaccctgcgtatgcgggagct |
11596648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 89; E-Value: 1e-42
Query Start/End: Original strand, 160 - 317
Target Start/End: Complemental strand, 35117927 - 35117765
Alignment:
| Q |
160 |
ggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaa--acagggtaaggctgcgtacaatacacc--aa |
255 |
Q |
| |
|
|||||||||||||||| |||||| ||||||||||||||||||||||| ||| ||||||||||||||| |||||||||||||| |||||||||||| || |
|
|
| T |
35117927 |
ggtaaagttgttgtcacgtgactgaaaggtcacgggttcaagtcctggaaatagcctcttgtgtaaaatacagggtaaggctgtgtacaatacaccaaaa |
35117828 |
T |
 |
| Q |
256 |
atggtgggaccccttcccggaccctgcat-atgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
||| ||||||||||||||||||||||| | |||| |||||| |||||||||||| | |||||| |
|
|
| T |
35117827 |
atgatgggaccccttcccggaccctgcgtaatgcaggagctttagtgcaccgggcttcccttt |
35117765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 87; E-Value: 2e-41
Query Start/End: Original strand, 224 - 318
Target Start/End: Original strand, 4349703 - 4349797
Alignment:
| Q |
224 |
aaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttta |
318 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
4349703 |
aaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttta |
4349797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 87; E-Value: 2e-41
Query Start/End: Original strand, 161 - 296
Target Start/End: Complemental strand, 25468421 - 25468284
Alignment:
| Q |
161 |
gtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatg |
258 |
Q |
| |
|
|||||||||||||||||||| | |||||||| |||||||||||||| ||||| |||||||||||||| |||||||||| |||||||||||||||||||| |
|
|
| T |
25468421 |
gtaaagttgttgtcatgtgattgaaaggtcatgggttcaagtcctggaaacaacctcttgtgtaaaaatcagggtaaggttgcgtacaatacaccaaatg |
25468322 |
T |
 |
| Q |
259 |
gtgggaccccttcccggaccctgcatatgcgggagctc |
296 |
Q |
| |
|
|| ||||| |||||| |||||||| ||||||||||||| |
|
|
| T |
25468321 |
gttggacctcttcccagaccctgcgtatgcgggagctc |
25468284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 86; E-Value: 7e-41
Query Start/End: Original strand, 144 - 317
Target Start/End: Original strand, 9939443 - 9939622
Alignment:
| Q |
144 |
taaccttggcgccactggtaaa-gttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgta--aaacagggtaaggctg |
240 |
Q |
| |
|
|||||||||||| || |||||| ||||||||||||||||| |||||||||| |||||||||||| ||||| |||||||| || ||||| ||||||| || |
|
|
| T |
9939443 |
taaccttggcgcaaccggtaaaagttgttgtcatgtgactgaaaggtcacgagttcaagtcctggaaacaacctcttgtttaagaaacatggtaaggttg |
9939542 |
T |
 |
| Q |
241 |
cgtacaatacacc--aaatggtggga-ccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
||| ||||||||| ||||||||||| ||||||| |||||||||| |||||||||||| |||||||||||||| |||||| |
|
|
| T |
9939543 |
cgtgcaatacaccaaaaatggtgggacccccttctcggaccctgcgtatgcgggagctttagtgcaccgggttacccttt |
9939622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 86; E-Value: 7e-41
Query Start/End: Original strand, 137 - 315
Target Start/End: Complemental strand, 19932934 - 19932755
Alignment:
| Q |
137 |
tgaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggta |
234 |
Q |
| |
|
|||||||| |||||||||| |||||||||||||||||||||||||| |||||||| |||||||||| || | ||| ||| |||||||||| ||||||| |
|
|
| T |
19932934 |
tgaggggttaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcatgggttcaagt--tggatacaacct-ttgtgtaaaaaacagggta |
19932838 |
T |
 |
| Q |
235 |
aggctgcgtacaatacacc--aaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccct |
315 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||| ||||| || | ||||||||| ||||||||| |
|
|
| T |
19932837 |
aggctgcgtacaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgcaagatcattagtgcaccaggttgccct |
19932755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 85; E-Value: 3e-40
Query Start/End: Original strand, 147 - 307
Target Start/End: Complemental strand, 2435958 - 2435796
Alignment:
| Q |
147 |
ccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaaggctgcgta |
244 |
Q |
| |
|
||||||||| || |||||||||||||||| |||||| ||||||||||||||||||||||| |||||||||| ||||| |||| |||||||| ||||||| |
|
|
| T |
2435958 |
ccttggcgcaac-ggtaaagttgttgtcacgtgactgaaaggtcacgggttcaagtcctggaaacagcctcctgtgtgaaaaatagggtaagcctgcgta |
2435860 |
T |
 |
| Q |
245 |
caatacacc-aaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgg |
307 |
Q |
| |
|
||||||||| ||||||||||||||||| ||| ||||| | ||||||||||| ||||||||||| |
|
|
| T |
2435859 |
caatacaccaaaatggtgggacccctttccgtaccctccgcatgcgggagctttagtgcaccgg |
2435796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 85; E-Value: 3e-40
Query Start/End: Original strand, 202 - 317
Target Start/End: Complemental strand, 31382330 - 31382214
Alignment:
| Q |
202 |
tcctgaaaacagcctcttgtgtaaaa-cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagt |
300 |
Q |
| |
|
||||| |||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| || | |
|
|
| T |
31382330 |
tcctggaaacagcctcttgtgtaaaaacaggataaggctgcgtacaatacaccaaatggtgggaccccttcctggaccctgcatatgcgggagctttact |
31382231 |
T |
 |
| Q |
301 |
gcaccgggttgcccttt |
317 |
Q |
| |
|
| ||||||||||||||| |
|
|
| T |
31382230 |
gtaccgggttgcccttt |
31382214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 81; E-Value: 7e-38
Query Start/End: Original strand, 160 - 314
Target Start/End: Complemental strand, 10378884 - 10378738
Alignment:
| Q |
160 |
ggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatgg |
259 |
Q |
| |
|
|||||||||||||||| |||||| |||||| |||||||||||||||| ||| || | |||||||||||||||||||||||||||||||||||| |
|
|
| T |
10378884 |
ggtaaagttgttgtcacgtgactgaaaggttacgggttcaagtcctggaaag-------tgag-aaaacagggtaaggctgcgtacaatacaccaaatgg |
10378793 |
T |
 |
| Q |
260 |
tgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccc |
314 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| |||||||||||| ||||| |
|
|
| T |
10378792 |
tgggaccccttcttggaccctgcatatgcgggagctttagtgcaccgggctgccc |
10378738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 81; E-Value: 7e-38
Query Start/End: Original strand, 161 - 305
Target Start/End: Original strand, 19701570 - 19701717
Alignment:
| Q |
161 |
gtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaaggctgcgtacaatacacc-aaat |
257 |
Q |
| |
|
|||||||||||||| ||||||| ||| |||||||||| ||||| ||||||||||||||||||| ||||| ||||||| || |||||||||||| |||| |
|
|
| T |
19701570 |
gtaaagttgttgtcgtgtgactgaaatgtcacgggtttaagtcatgaaaacagcctcttgtgtaaaaaacttggtaaggatgggtacaatacaccaaaat |
19701669 |
T |
 |
| Q |
258 |
ggtgggaccccttcccggaccctgcatatgcgggagctctagtgcacc |
305 |
Q |
| |
|
|||||| |||||||||||||||||| |||||||||||| ||||||||| |
|
|
| T |
19701670 |
ggtggggccccttcccggaccctgcgtatgcgggagctttagtgcacc |
19701717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 81; E-Value: 7e-38
Query Start/End: Original strand, 135 - 308
Target Start/End: Complemental strand, 44485292 - 44485119
Alignment:
| Q |
135 |
tctgaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--caggg |
232 |
Q |
| |
|
||||||||| | ||||||||| || | ||||||||||||||||||| | |||||||||||||| ||||||| ||||| || ||||||||||| || || |
|
|
| T |
44485292 |
tctgagggggagccttggcgcaacag-taaagttgttgtcatgtgattgaaaggtcacgggttatagtcctggaaacaaccacttgtgtaaaagacatgg |
44485194 |
T |
 |
| Q |
233 |
taaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccggg |
308 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||| ||| | |||||||||||| | |||||||||| |
|
|
| T |
44485193 |
taaggctgcgtacaatacaccaaatggttggaccccttcccggatcctacgtatgcgggagct-ttgtgcaccggg |
44485119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 80; E-Value: 3e-37
Query Start/End: Original strand, 159 - 293
Target Start/End: Original strand, 20036218 - 20036355
Alignment:
| Q |
159 |
tggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaa---acagggtaaggctgcgtacaatacaccaa |
255 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| ||||| |||||||||||| | |||||||| ||||| ||||||||||| |
|
|
| T |
20036218 |
tggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacaaactcttgtgtaaagagaaagggtaagattgcgttcaatacaccaa |
20036317 |
T |
 |
| Q |
256 |
atggtgggaccccttcccggaccctgcatatgcgggag |
293 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||| |
|
|
| T |
20036318 |
atggtggaaccccttcccggaccctgcgtatgcaggag |
20036355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 73; E-Value: 4e-33
Query Start/End: Original strand, 138 - 263
Target Start/End: Complemental strand, 4430207 - 4430080
Alignment:
| Q |
138 |
gaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaa |
235 |
Q |
| |
|
||||| ||| |||||||| ||||||||||||||||||||||||| ||||||||||||| ||||| ||||||||| |||||||| |||||||||||| |
|
|
| T |
4430207 |
gagggttaatcttggcgcagctggtaaagttgttgtcatgtgactggaaggtcacgggtttaagtcttgaaaacagtatcttgtgtaaaaaacagggtaa |
4430108 |
T |
 |
| Q |
236 |
ggctgcgtacaatacaccaaatggtggg |
263 |
Q |
| |
|
| |||||||||||||||||||||||||| |
|
|
| T |
4430107 |
gactgcgtacaatacaccaaatggtggg |
4430080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 73; E-Value: 4e-33
Query Start/End: Original strand, 147 - 317
Target Start/End: Original strand, 50811926 - 50812098
Alignment:
| Q |
147 |
ccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa---cagggtaaggctgcgt |
243 |
Q |
| |
|
||||||||| || |||||||||||||||| |||||| ||||||||||| ||| |||||| ||||||| |||||||||||| |||||||||| ||||| |
|
|
| T |
50811926 |
ccttggcgcaac-ggtaaagttgttgtcacgtgactgaaaggtcacggaatcatgtcctggaaacagcttcttgtgtaaaaaaacagggtaaggttgcgt |
50812024 |
T |
 |
| Q |
244 |
acaatacacc-aaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||| |||||| |||||||||||| || ||||| ||| |||||||| |
|
|
| T |
50812025 |
acaatacaccaaaatggt-ggaccccttcccgcgccctgcgtatgcgggagctttaatgcactgggctgcccttt |
50812098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 72; E-Value: 2e-32
Query Start/End: Original strand, 148 - 320
Target Start/End: Original strand, 33222971 - 33223152
Alignment:
| Q |
148 |
cttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt-aaaacagggtaaggctgcgtaca |
246 |
Q |
| |
|
|||||||| || ||||||||||||||||||||||| ||||||||||| || ||||| || |||||||||||||||| ||||||||| |||| |||||||| |
|
|
| T |
33222971 |
cttggcgcaaccggtaaagttgttgtcatgtgactgaaaggtcacggatttaagtcatggaaacagcctcttgtgtaaaaacagggaaaggttgcgtaca |
33223070 |
T |
 |
| Q |
247 |
atacacc-aaatggtg-------ggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttaat |
320 |
Q |
| |
|
||||||| |||||||| |||||||||||||||| |||| |||| | |||||||||||||| | ||| |||||||| |
|
|
| T |
33223071 |
atacaccaaaatggtgggaccccggaccccttcccggactctgcctatgtagaagctctagtgcaccagattgtcctttaat |
33223152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 70; E-Value: 3e-31
Query Start/End: Original strand, 203 - 317
Target Start/End: Original strand, 23796507 - 23796623
Alignment:
| Q |
203 |
cctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagt |
300 |
Q |
| |
|
|||| |||||||||||||||||||| || |||||| ||||||||||||||||||||||| ||||||||||| |||||||||||||| |||||| |||| |
|
|
| T |
23796507 |
cctggaaacagcctcttgtgtaaaaatcaatgtaaggttgcgtacaatacaccaaatggtgagaccccttcccagaccctgcatatgctggagctttagt |
23796606 |
T |
 |
| Q |
301 |
gcaccgggttgcccttt |
317 |
Q |
| |
|
|||||||| |||||||| |
|
|
| T |
23796607 |
gcaccgggctgcccttt |
23796623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 70; E-Value: 3e-31
Query Start/End: Original strand, 147 - 313
Target Start/End: Original strand, 35019217 - 35019383
Alignment:
| Q |
147 |
ccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgta |
244 |
Q |
| |
|
||||||||| || |||||||||||||||| ||||| ||||||||| | ||||||||||| ||||| |||||||| ||||| ||| ||||||||| || |
|
|
| T |
35019217 |
ccttggcgcaac-ggtaaagttgttgtcacatgactgaaaggtcacagattcaagtcctgtaaacaacctcttgtataaaaatcagtataaggctgcata |
35019315 |
T |
 |
| Q |
245 |
caatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcc |
313 |
Q |
| |
|
||||||||||| |||||||||||| |||| |||||||| |||||| ||||| |||||||||||| |||| |
|
|
| T |
35019316 |
caatacaccaattggtgggacccc-tcccagaccctgcgtatgcgagagctttagtgcaccgggctgcc |
35019383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 159 - 315
Target Start/End: Complemental strand, 15511311 - 15511150
Alignment:
| Q |
159 |
tggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcg--tacaatacacca |
254 |
Q |
| |
|
||||||||||||||| ||||| || ||||||||| || |||||||| |||| ||||||||||||||| ||||||||||||||| |||||||||||| |
|
|
| T |
15511311 |
tggtaaagttgttgtaatgtggctgaaaggtcacatattgaagtcctggaaaccgcctcttgtgtaaaaaacagggtaaggctgcggatacaatacacca |
15511212 |
T |
 |
| Q |
255 |
aa-tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccct |
315 |
Q |
| |
|
|| |||||| ||||||||| ||||||||| |||| | ||||| |||||||||||| |||||| |
|
|
| T |
15511211 |
aaatggtggtaccccttcctggaccctgcgtatgtgtgagctttagtgcaccgggctgccct |
15511150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 160 - 255
Target Start/End: Complemental strand, 50760385 - 50760288
Alignment:
| Q |
160 |
ggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtg--taaaacagggtaaggctgcgtacaatacaccaa |
255 |
Q |
| |
|
|||||||| |||||||||||||| | ||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||| |||||||||| |
|
|
| T |
50760385 |
ggtaaagtagttgtcatgtgactgagaggtcacgggttcaagtcctgaaaacagcctcttgtgtataaaactgggtaaggctgcgtataatacaccaa |
50760288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 160 - 272
Target Start/End: Complemental strand, 17470505 - 17470390
Alignment:
| Q |
160 |
ggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaaggctgcgtacaatacacc-aaa |
256 |
Q |
| |
|
|||||||||||||||| |||||| || ||||| ||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||| ||| |
|
|
| T |
17470505 |
ggtaaagttgttgtcacgtgactgaatggtcatgggttcaagtcctagaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaaa |
17470406 |
T |
 |
| Q |
257 |
tggtgggaccccttcc |
272 |
Q |
| |
|
| ||||||||| |||| |
|
|
| T |
17470405 |
tagtgggacccgttcc |
17470390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 224 - 317
Target Start/End: Complemental strand, 1517404 - 1517311
Alignment:
| Q |
224 |
aaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|||||| | ||||||||||||||||||||||| ||||||||||||||| | |||||||| ||||| |||||| ||||||||||||||||||||| |
|
|
| T |
1517404 |
aaaacatgataaggctgcgtacaatacaccaattggtgggaccccttctcagaccctgcgtatgcaggagctttagtgcaccgggttgcccttt |
1517311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 161 - 314
Target Start/End: Complemental strand, 39215117 - 39214961
Alignment:
| Q |
161 |
gtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaaggctgcgtacaatacacc-aaat |
257 |
Q |
| |
|
|||||||| |||||| |||||||||||||| | |||||||| ||| ||||| |||||||||| ||||| |||||||||||||||||||| || |||| |
|
|
| T |
39215117 |
gtaaagttattgtcacgtgactaaaaggtcccaagttcaagtactggaaacaacctcttgtgtaaaaaactgggtaaggctgcgtacaatattccaaaat |
39215018 |
T |
 |
| Q |
258 |
ggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccc |
314 |
Q |
| |
|
|||||| ||||||||| ||||||| |||| || |||| |||||||||||| ||||| |
|
|
| T |
39215017 |
ggtgggtccccttcccaaaccctgcgtatgtggaagctttagtgcaccgggctgccc |
39214961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 184 - 305
Target Start/End: Complemental strand, 45264535 - 45264411
Alignment:
| Q |
184 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaa-tggtgggaccccttcccggaccct |
280 |
Q |
| |
|
||||||||| |||||||||||| ||||| ||||||||| |||| ||| ||||||||| || |||||||||||| ||||||||||||||| | |||||| |
|
|
| T |
45264535 |
aaaggtcacatgttcaagtcctggaaacaacctcttgtgcaaaaaacagagtaaggctgtgtgcaatacaccaaaatggtgggaccccttctcagaccct |
45264436 |
T |
 |
| Q |
281 |
gcatatgcgggagctctagtgcacc |
305 |
Q |
| |
|
||||||||||||||| ||||||||| |
|
|
| T |
45264435 |
gcatatgcgggagctttagtgcacc |
45264411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 61; E-Value: 6e-26
Query Start/End: Original strand, 141 - 287
Target Start/End: Original strand, 25290143 - 25290300
Alignment:
| Q |
141 |
gggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaaca--gcctcttgtgtaaaa--cagggtaag |
236 |
Q |
| |
|
||||||||||||||| || ||||||||||||||||||||||| |||||||||| ||||||||| || ||||| ||||||||||||||| ||||||||| |
|
|
| T |
25290143 |
gggtaaccttggcgcaacaggtaaagttgttgtcatgtgactgaaaggtcacgtgttcaagtcttggaaacacagcctcttgtgtaaaaaacagggtaag |
25290242 |
T |
 |
| Q |
237 |
gc-----tgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcatatg |
287 |
Q |
| |
|
|| || ||||||||||||||| || | |||||||||||| ||| ||||||||| |
|
|
| T |
25290243 |
gcaaggttgtgtacaatacaccaaaaatgataggaccccttcccagactctgcatatg |
25290300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 61; E-Value: 6e-26
Query Start/End: Original strand, 224 - 317
Target Start/End: Complemental strand, 42304302 - 42304207
Alignment:
| Q |
224 |
aaaacagggtaaggctgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||| |||||||||||||||||||||||||| |||| ||||||| ||||||||||| ||||||||| |
|
|
| T |
42304302 |
aaaacagggtaaggttgcgtacaatacacaaaaaatggtgggaccccttcccggaccctgcgtatgtgggagctttagtgcaccggattgcccttt |
42304207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #53
Raw Score: 61; E-Value: 6e-26
Query Start/End: Original strand, 225 - 317
Target Start/End: Original strand, 43768205 - 43768297
Alignment:
| Q |
225 |
aaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
||||||||||||||||| ||||||||||||| ||||||||||||||||| |||||||| ||| |||||||| || ||||||||| |||||||| |
|
|
| T |
43768205 |
aaacagggtaaggctgcctacaatacaccaattggtgggaccccttcccagaccctgcgtatacgggagctttaatgcaccgggctgcccttt |
43768297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #54
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 254 - 317
Target Start/End: Original strand, 50606498 - 50606561
Alignment:
| Q |
254 |
aaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
50606498 |
aaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcccttt |
50606561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #55
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 193 - 315
Target Start/End: Original strand, 22324925 - 22325049
Alignment:
| Q |
193 |
gggttcaagtcctgaaaacagcctcttgtgtaaaa-cagggtaaggctgcgtacaatacacc--aaatggtgggaccccttcccggaccctgcatatgcg |
289 |
Q |
| |
|
||||||||||| || |||||||||||||||||||| |||||||||||||| ||||||||||| ||||||||| |||| |||| |||||||| |||||| |
|
|
| T |
22324925 |
gggttcaagtcttggaaacagcctcttgtgtaaaaacagggtaaggctgcatacaatacaccaaaaatggtggagccccgtccc-gaccctgcgtatgcg |
22325023 |
T |
 |
| Q |
290 |
ggagctctagtgcaccgggttgccct |
315 |
Q |
| |
|
|||||| ||||||||| || |||||| |
|
|
| T |
22325024 |
ggagctttagtgcaccaggctgccct |
22325049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #56
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 163 - 313
Target Start/End: Original strand, 22327101 - 22327250
Alignment:
| Q |
163 |
aaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaaggctgcgtacaatacacc-aaatgg |
259 |
Q |
| |
|
|||||||||||||||||||| ||||||| ||||||||||||||| ||||| |||||||||| ||||||||||||||||| |||| || |||| |||||| |
|
|
| T |
22327101 |
aaagttgttgtcatgtgactgaaaggtcgcgggttcaagtcctggaaacaacctcttgtgtaaaaaacagggtaaggctgtgtacgatgcaccaaaatgg |
22327200 |
T |
 |
| Q |
260 |
tgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcc |
313 |
Q |
| |
|
|||| |||||| || ||| |||||||||||| | |||||||||| |||| |
|
|
| T |
22327201 |
tggg----gttcccgaactctgtgtatgcgggagctttggtgcaccgggctgcc |
22327250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #57
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 227 - 295
Target Start/End: Original strand, 15505632 - 15505700
Alignment:
| Q |
227 |
acagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagct |
295 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
15505632 |
acagggtaagactgcgtacaatacaccaaatggtgggaccccttcccgaaccctgcgtatgcgggagct |
15505700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #58
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 161 - 308
Target Start/End: Original strand, 23371124 - 23371271
Alignment:
| Q |
161 |
gtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaaca-gggtaaggctgcgtacaatacaccaaatgg |
259 |
Q |
| |
|
||||||||||| || ||||| |||||||||||||||||||||| |||||||| |||| |||||| | ||| |||| || ||||||||||||||||| |
|
|
| T |
23371124 |
gtaaagttgttttcgcatgactgaaaggtcacgggttcaagtcctagaaacagccacttgggtaaaaaacgggcaaggttgtgtacaatacaccaaatgc |
23371223 |
T |
 |
| Q |
260 |
tgggaccccttcccggaccctgcatatgcgggagctctagtgcaccggg |
308 |
Q |
| |
|
||||||||||| || |||||||| |||| || |||| |||||||||||| |
|
|
| T |
23371224 |
tgggacccctt-ccagaccctgcgtatgtggtagctttagtgcaccggg |
23371271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #59
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 171 - 317
Target Start/End: Complemental strand, 31272522 - 31272381
Alignment:
| Q |
171 |
tgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt-aaaacagggtaaggctgcgtacaatacaccaaatggtgggacccct |
269 |
Q |
| |
|
||||| |||||| ||||||||| ||||||||||||| ||||| |||||||||| |||||| |||||||||||||||| ||| ||||||||||| |
|
|
| T |
31272522 |
tgtcacgtgactgaaaggtcacaggttcaagtcctggaaacaacctcttgtgtaaaaacatggtaaggctgcgtacagcacatcaaatggtggg------ |
31272429 |
T |
 |
| Q |
270 |
tcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
| ||||||||||| |||||||||||| ||||| || ||| |||||||| |
|
|
| T |
31272428 |
ttccggaccctgcgtatgcgggagctttagtggactgggctgcccttt |
31272381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #60
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 203 - 308
Target Start/End: Complemental strand, 34149076 - 34148969
Alignment:
| Q |
203 |
cctgaaaacagcctcttgtgta--aaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagt |
300 |
Q |
| |
|
|||| ||||||||||||||||| ||| ||||||||| ||||||||| | ||||||||||| |||||||||| ||||||||||||||| ||||| ||||| |
|
|
| T |
34149076 |
cctggaaacagcctcttgtgtagaaaatagggtaaggttgcgtacaaaagaccaaatggtgagaccccttcctggaccctgcatatgcaggagcgctagt |
34148977 |
T |
 |
| Q |
301 |
gcaccggg |
308 |
Q |
| |
|
||| |||| |
|
|
| T |
34148976 |
gcaacggg |
34148969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #61
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 137 - 213
Target Start/End: Original strand, 34714599 - 34714675
Alignment:
| Q |
137 |
tgaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacag |
213 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||| | |||||||||||||||||||| || |||||| |
|
|
| T |
34714599 |
tgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgattgaaaggtcacgggttcaagtcatggaaacag |
34714675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #62
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 172 - 317
Target Start/End: Complemental strand, 19974221 - 19974074
Alignment:
| Q |
172 |
gtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaac-agggtaaggctgcgtacaatacaccaaa-tggtgggacccct |
269 |
Q |
| |
|
|||| |||||| |||| ||||||||||||||| || |||||||||| |||||||| |||| |||| |||||||||||||||||| || |||||||| | |
|
|
| T |
19974221 |
gtcacgtgactgaaagatcacgggttcaagtcttggaaacagcctcaagtgtaaaaatagggcaaggttgcgtacaatacaccaaaatgatgggacccat |
19974122 |
T |
 |
| Q |
270 |
tcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|||||||| || |||||||||||| |||||||| ||| |||||||| |
|
|
| T |
19974121 |
tcccggactctatgtatgcgggagctttagtgcacggggctgcccttt |
19974074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #63
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 160 - 307
Target Start/End: Complemental strand, 27136811 - 27136661
Alignment:
| Q |
160 |
ggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaaggctgcgtacaatacacc-aaa |
256 |
Q |
| |
|
|||||||||||||||| |||| | |||| |||| |||||||| ||| |||| |||||||||| |||||| ||||||| ||||||||||||||| ||| |
|
|
| T |
27136811 |
ggtaaagttgttgtcacgtgattggaaggacacgagttcaagttctgggaacaacctcttgtgtaaaaaacatggtaaggttgcgtacaatacaccaaaa |
27136712 |
T |
 |
| Q |
257 |
tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgg |
307 |
Q |
| |
|
|||||||||||||||| || | || ||||||||||||| |||||||||| |
|
|
| T |
27136711 |
tggtgggaccccttcctagatcatgtgtatgcgggagctccagtgcaccgg |
27136661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #64
Raw Score: 54; E-Value: 9e-22
Query Start/End: Original strand, 224 - 317
Target Start/End: Complemental strand, 20999943 - 20999850
Alignment:
| Q |
224 |
aaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|||||| || ||||||||||||||||||||||||| |||| |||||||| | ||||||| || ||||||||| |||||||||||| |||||||| |
|
|
| T |
20999943 |
aaaacaaggcaaggctgcgtacaatacaccaaatgatggggccccttccggcaccctgcgtacgcgggagctttagtgcaccgggctgcccttt |
20999850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #65
Raw Score: 54; E-Value: 9e-22
Query Start/End: Original strand, 139 - 317
Target Start/End: Original strand, 24564322 - 24564492
Alignment:
| Q |
139 |
aggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaag |
236 |
Q |
| |
|
||||||||||||||||| || ||||||||| |||| ||||| | ||||||| | | |||||||| || ||||| |||||||||| ||||||||||||| |
|
|
| T |
24564322 |
aggggtaaccttggcgcaaccagtaaagttgatgtcttgtgattgaaaggtcgcagattcaagtcttggaaacaacctcttgtgtaaaaaacagggtaag |
24564421 |
T |
 |
| Q |
237 |
gctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
| |||||||||| ||||||||||| ||| ||||||||| ||||| ||||| ||||||||||||||||||||| |
|
|
| T |
24564422 |
ggtgcgtacaattcaccaaatggt-------ctt---ggaccctgcctatgcaggagcgttagtgcaccgggttgcccttt |
24564492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #66
Raw Score: 54; E-Value: 9e-22
Query Start/End: Original strand, 140 - 205
Target Start/End: Original strand, 40424721 - 40424786
Alignment:
| Q |
140 |
ggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcct |
205 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
40424721 |
ggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggccacgggttcaagtcct |
40424786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #67
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 192 - 295
Target Start/End: Original strand, 30682845 - 30682948
Alignment:
| Q |
192 |
cgggttcaagtcctgaaaacagcctcttgtgtaaaa-cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgg |
290 |
Q |
| |
|
||||||||| ||||||||| |||||||||||||||| || |||||| || ||||| |||| |||||||||||||||||||||||||| ||| ||||||| |
|
|
| T |
30682845 |
cgggttcaaatcctgaaaatagcctcttgtgtaaaaacaaggtaagattgtgtaca-tacaacaaatggtgggaccccttcccggaccgtgcgtatgcgg |
30682943 |
T |
 |
| Q |
291 |
gagct |
295 |
Q |
| |
|
||||| |
|
|
| T |
30682944 |
gagct |
30682948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #68
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 162 - 317
Target Start/End: Complemental strand, 19656263 - 19656105
Alignment:
| Q |
162 |
taaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaaggctgcgtacaatacacc-aaatg |
258 |
Q |
| |
|
||||||||||||| |||||| ||||||||| | ||||| | || |||||||||||||||| |||||| ||||| ||| |||||||||||| ||||| |
|
|
| T |
19656263 |
taaagttgttgtcgcgtgactcaaaggtcactagctcaaggcttggaaacagcctcttgtgtaaaaaacatggtaacgctatgtacaatacaccaaaatg |
19656164 |
T |
 |
| Q |
259 |
gtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|| |||||| ||| ||||||||||||||| ||||| || ||||||||| |||||||| |
|
|
| T |
19656163 |
gtaggaccctttcttggaccctgcatatgcaagagctttaatgcaccgggctgcccttt |
19656105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #69
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 224 - 310
Target Start/End: Complemental strand, 31442483 - 31442396
Alignment:
| Q |
224 |
aaaacagggtaaggctgcgtacaatacaccaaa-tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggtt |
310 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| ||||||||||||||||||||| ||| |||| ||||||| | |||||||||||| |
|
|
| T |
31442483 |
aaaacagggtaaggatgcgtacaatacaccaaaatggtgggaccccttcccggacactgtgtatgtgggagctttggtgcaccgggtt |
31442396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #70
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 250 - 312
Target Start/End: Complemental strand, 4587630 - 4587568
Alignment:
| Q |
250 |
caccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgc |
312 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||| |
|
|
| T |
4587630 |
caccaaatggtgggaccccttcccggaccctgcctatgcgggagcttcagtgcaccgggttgc |
4587568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #71
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 142 - 272
Target Start/End: Complemental strand, 18335465 - 18335333
Alignment:
| Q |
142 |
ggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggct |
239 |
Q |
| |
|
|||||||||||||| | || ||||||| |||||||||| || ||||||||| ||| |||||||| |||||| ||||||| ||||| ||||||| | | |
|
|
| T |
18335465 |
ggtaaccttggcgcaagtgataaagtttttgtcatgtgtctgaaaggtcacaagttaaagtcctggaaacagtctcttgtttaaaaattagggtaaagtt |
18335366 |
T |
 |
| Q |
240 |
gcgtacaatacaccaaatggtgggaccccttcc |
272 |
Q |
| |
|
|||||||||||| |||||| |||||||| |||| |
|
|
| T |
18335365 |
gcgtacaatacatcaaatgatgggaccctttcc |
18335333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #72
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 201 - 295
Target Start/End: Complemental strand, 20169207 - 20169111
Alignment:
| Q |
201 |
gtcctgaaaacagcctcttgtgtaaaacag--ggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagct |
295 |
Q |
| |
|
|||||||||||| |||||||||||||| | |||||| ||| ||||||||| |||| |||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
20169207 |
gtcctgaaaacaccctcttgtgtaaaaaaaaaggtaagactgtgtacaataccccaatcggtgggactccttcccggaccctgcatatgcgggagct |
20169111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #73
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 160 - 227
Target Start/End: Complemental strand, 2436052 - 2435985
Alignment:
| Q |
160 |
ggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa |
227 |
Q |
| |
|
|||||||||||||||| |||||| ||||||||||||||||||||||| ||||| |||| ||||||||| |
|
|
| T |
2436052 |
ggtaaagttgttgtcacgtgactgaaaggtcacgggttcaagtcctggaaacaacctcctgtgtaaaa |
2435985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #74
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 160 - 314
Target Start/End: Original strand, 52910216 - 52910379
Alignment:
| Q |
160 |
ggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt---aaaacagggtaaggctgcgtacaatacaccaa- |
255 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| ||||||| || || |||||||||||| || ||||||||||| | ||| |||||||||||| | |
|
|
| T |
52910216 |
ggtaaagttgttgtcatgtgactgaaaggtcacaggttcaactcttggaaacagcctcttaggtaaaaaaacagggtaggactgtgtacaatacacctaa |
52910315 |
T |
 |
| Q |
256 |
-----atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccc |
314 |
Q |
| |
|
||||||||||||||||| ||| ||| | |||| |||| || ||||||||| || ||||| |
|
|
| T |
52910316 |
tggttatggtgggaccccttcctggaacctccgtatgtgggaactttagtgcaccaggctgccc |
52910379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #75
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 157 - 247
Target Start/End: Complemental strand, 14988081 - 14987989
Alignment:
| Q |
157 |
actggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaa--acagggtaaggctgcgtacaa |
247 |
Q |
| |
|
|||||||||||||||||||| |||||| || ||||| ||||||||||||||||||| |||| |||||| ||||| ||||||||||||||| |
|
|
| T |
14988081 |
actggtaaagttgttgtcatatgactagaaagtcacaagttcaagtcctgaaaacagtatcttatgtaaaatacaggataaggctgcgtacaa |
14987989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #76
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 224 - 280
Target Start/End: Complemental strand, 21910742 - 21910686
Alignment:
| Q |
224 |
aaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccct |
280 |
Q |
| |
|
|||| ||||||||| |||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
21910742 |
aaaatagggtaaggttgcgtacaatacaccaaatggtgggaccccttcccgaaccct |
21910686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #77
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 159 - 240
Target Start/End: Complemental strand, 25554882 - 25554800
Alignment:
| Q |
159 |
tggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgta-aaacagggtaaggctg |
240 |
Q |
| |
|
||||||||||||||||| |||||||||||| |||| ||| |||||||| ||||| ||||||||||| ||||| |||| ||||| |
|
|
| T |
25554882 |
tggtaaagttgttgtcacgtgactaaaaggccacgtgtttaagtcctggaaacaacctcttgtgtagaaacacggtagggctg |
25554800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #78
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 138 - 227
Target Start/End: Original strand, 10163736 - 10163825
Alignment:
| Q |
138 |
gaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa |
227 |
Q |
| |
|
|||||||||| ||||||| |||| |||||||||||||||||| |||||| || || ||| |||| ||||||||| |||||| ||||||| |
|
|
| T |
10163736 |
gaggggtaacattggcgcaactgataaagttgttgtcatgtggctaaaatgttacaagtttaagttctgaaaacaacctcttatgtaaaa |
10163825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #79
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 139 - 249
Target Start/End: Complemental strand, 18336026 - 18335914
Alignment:
| Q |
139 |
aggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaa--aacagggtaag |
236 |
Q |
| |
|
|||||||| |||||||| | || ||||||||||| |||||| || ||||||||| |||||||| ||||||| | || |||| ||| ||||||||||| |
|
|
| T |
18336026 |
aggggtaatcttggcgcaagtgataaagttgttgccatgtgtctgaaaggtcacatgttcaagttctgaaaataatctattgtttaaagaacagggtaag |
18335927 |
T |
 |
| Q |
237 |
gctgcgtacaata |
249 |
Q |
| |
|
||||||||||||| |
|
|
| T |
18335926 |
gctgcgtacaata |
18335914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #80
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 160 - 315
Target Start/End: Complemental strand, 34679378 - 34679217
Alignment:
| Q |
160 |
ggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaat |
257 |
Q |
| |
|
||||||||| ||||||||||||| ||| |||| |||| | |||| ||||| |||||||||||||| ||||||||| |||||||| ||||| ||||| |
|
|
| T |
34679378 |
ggtaaagttattgtcatgtgactgaaatatcacatgttccattcctagaaacaacctcttgtgtaaaaaacagggtaagactgcgtactatacatcaaat |
34679279 |
T |
 |
| Q |
258 |
ggtgggaccccttcccggac----cctgcatatgcgggagctctagtgcaccgggttgccct |
315 |
Q |
| |
|
||||| |||| | || ||| ||||| |||||||||||| |||| ||||||| |||||| |
|
|
| T |
34679278 |
ggtggagccccgttccagacccggcctgcgtatgcgggagctttagtacaccgggctgccct |
34679217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #81
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 208 - 287
Target Start/End: Original strand, 21723731 - 21723811
Alignment:
| Q |
208 |
aaacagcctcttgtgtaaaac-agggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatg |
287 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||| ||||||||||||||||||| | ||| |||||||||||||| |||| |
|
|
| T |
21723731 |
aaacagcctcttgtataaaaatagggtaaggctgagtacaatacaccaaatggtagaaccttttcccggaccctgcgtatg |
21723811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #82
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 254 - 317
Target Start/End: Original strand, 30555210 - 30555273
Alignment:
| Q |
254 |
aaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|||||||||||||||||| |||||||||| |||||| ||||| |||||||||||| || ||||| |
|
|
| T |
30555210 |
aaatggtgggaccccttcacggaccctgcgtatgcgagagctttagtgcaccgggctgaccttt |
30555273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #83
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 236 - 302
Target Start/End: Complemental strand, 4430080 - 4430014
Alignment:
| Q |
236 |
ggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgc |
302 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| | ||| |||| |||||||||||| |||||| |
|
|
| T |
4430080 |
ggctgcgtacaatacaccaaatggtggaacccctttctggatcctgtgtatgcgggagctttagtgc |
4430014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #84
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 228 - 301
Target Start/End: Original strand, 6358190 - 6358264
Alignment:
| Q |
228 |
cagggtaaggctgcgtacaatacaccaaa-tggtgggaccccttcccggaccctgcatatgcgggagctctagtg |
301 |
Q |
| |
|
|||||||| ||||||||||| |||||||| ||||||||||||||||| |||||||| ||||| ||| || ||||| |
|
|
| T |
6358190 |
cagggtaaagctgcgtacaaaacaccaaaatggtgggaccccttcccagaccctgcgtatgcaggatctttagtg |
6358264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #85
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 267 - 317
Target Start/End: Complemental strand, 19386626 - 19386576
Alignment:
| Q |
267 |
ccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| |||||| |||| |
|
|
| T |
19386626 |
ccttcccggaccctgcatatgcgggagctctagtgaaccaggttgctcttt |
19386576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #86
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 224 - 294
Target Start/End: Complemental strand, 20982843 - 20982773
Alignment:
| Q |
224 |
aaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagc |
294 |
Q |
| |
|
|||| ||||||||||||| |||||||||| |||||||||| | |||| |||||||||| ||||||||||| |
|
|
| T |
20982843 |
aaaatagggtaaggctgccaacaatacacctaatggtgggatctcttctcggaccctgcgtatgcgggagc |
20982773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #87
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 139 - 225
Target Start/End: Original strand, 21723642 - 21723727
Alignment:
| Q |
139 |
aggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaa |
225 |
Q |
| |
|
|||||||||||| || | |||||||||||||||||||||||||| | ||| || |||| ||||||| |||||||||||||||||| |
|
|
| T |
21723642 |
aggggtaaccttcgcacaactggtaaagttgttgtcatgtgactggatggttacaagttc-agtcctggaaacagcctcttgtgtaa |
21723727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #88
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 240 - 305
Target Start/End: Complemental strand, 4249520 - 4249455
Alignment:
| Q |
240 |
gcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcacc |
305 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| ||| || |||||||||||| || |||||| |
|
|
| T |
4249520 |
gcgtacaatacaccaaatggtgggatcccttcccgaaccttgtgtatgcgggagctttaatgcacc |
4249455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #89
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 240 - 305
Target Start/End: Complemental strand, 4249844 - 4249779
Alignment:
| Q |
240 |
gcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcacc |
305 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| ||| || |||||||||||| || |||||| |
|
|
| T |
4249844 |
gcgtacaatacaccaaatggtgggatcccttcccgaaccttgtgtatgcgggagctttaatgcacc |
4249779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #90
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 240 - 305
Target Start/End: Complemental strand, 4250168 - 4250103
Alignment:
| Q |
240 |
gcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcacc |
305 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| ||| || |||||||||||| || |||||| |
|
|
| T |
4250168 |
gcgtacaatacaccaaatggtgggatcccttcccgaaccttgtgtatgcgggagctttaatgcacc |
4250103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #91
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 233 - 314
Target Start/End: Complemental strand, 28894642 - 28894561
Alignment:
| Q |
233 |
taaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccc |
314 |
Q |
| |
|
||||| ||||||||||||| |||||||| ||||||||| ||||||||||||||| ||||| ||||||||| || ||||| |
|
|
| T |
28894642 |
taaggttgcgtacaatacatcaaatggtaaaaccccttcctagaccctgcatatgcgagagctttagtgcaccaggctgccc |
28894561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #92
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 252 - 317
Target Start/End: Complemental strand, 33594196 - 33594131
Alignment:
| Q |
252 |
ccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|||| ||||||||||||||||| |||||||| |||||||||||| |||||||| ||| | |||||| |
|
|
| T |
33594196 |
ccaattggtgggaccccttcccagaccctgcgtatgcgggagctttagtgcactgggctacccttt |
33594131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #93
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 231 - 305
Target Start/End: Original strand, 7074588 - 7074663
Alignment:
| Q |
231 |
ggtaaggctgcgtacaatacaccaaa-tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcacc |
305 |
Q |
| |
|
|||| ||||||||||||||||||||| | |||||||| ||| | |||||||||||| |||||||| ||||||||| |
|
|
| T |
7074588 |
ggtatggctgcgtacaatacaccaaaattgtgggacctctttctagaccctgcatatccgggagctttagtgcacc |
7074663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #94
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 262 - 317
Target Start/End: Original strand, 16120819 - 16120874
Alignment:
| Q |
262 |
ggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| || |||||| || |||||||| |
|
|
| T |
16120819 |
ggaccccttcccggcccctgcatatgcgggagctttaatgcaccaggctgcccttt |
16120874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #95
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 147 - 303
Target Start/End: Original strand, 43207476 - 43207640
Alignment:
| Q |
147 |
ccttggcgccactggtaaagttgttgtcatgtgactaaaagg------tcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaaggc |
238 |
Q |
| |
|
||||||||| || |||||||||||||||| |||||| || || |||| |||| ||||| || ||||| |||||| ||| ||||||||||||| | |
|
|
| T |
43207476 |
ccttggcgcaac-ggtaaagttgttgtcacgtgactgaatggacacactcacaggtttaagtcttggaaacaacctcttatgtgaaaaacagggtaagac |
43207574 |
T |
 |
| Q |
239 |
tgcgtacaatacaccaaa-tggtgggaccccttcccggaccctgcatatgcgggagctctagtgca |
303 |
Q |
| |
|
|| |||||||||||||| |||||||||| |||||| |||||| |||||| ||||| ||||||| |
|
|
| T |
43207575 |
ggcatacaatacaccaaattggtgggacctcttcccagaccctatgtatgcgagagctttagtgca |
43207640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #96
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 44745900 - 44745854
Alignment:
| Q |
202 |
tcctgaaaacagcctcttgtgtaaaacagggtaaggctgcgtacaat |
248 |
Q |
| |
|
||||| |||||||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
44745900 |
tcctggaaacagcctcttgtgtaaaacaaggtaaagctgcgtacaat |
44745854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #97
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 152 - 225
Target Start/End: Original strand, 22151495 - 22151568
Alignment:
| Q |
152 |
gcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaa |
225 |
Q |
| |
|
|||| |||| ||||||||||||||| ||||| ||||||| ||||||||| ||| |||||||||||| ||||| |
|
|
| T |
22151495 |
gcgcaactgataaagttgttgtcatctgactgtaaggtcataggttcaagttctggaaacagcctcttatgtaa |
22151568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #98
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 276 - 315
Target Start/End: Original strand, 42432228 - 42432267
Alignment:
| Q |
276 |
accctgcatatgcgggagctctagtgcaccgggttgccct |
315 |
Q |
| |
|
||||||||||||| |||||||||||||||||| ||||||| |
|
|
| T |
42432228 |
accctgcatatgctggagctctagtgcaccggattgccct |
42432267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #99
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 243 - 303
Target Start/End: Complemental strand, 43921866 - 43921804
Alignment:
| Q |
243 |
tacaatacaccaaatggtgggacccc--ttcccggaccctgcatatgcgggagctctagtgca |
303 |
Q |
| |
|
|||||||||||||||||| ||||||| ||| ||||||||||| ||||| ||||| ||||||| |
|
|
| T |
43921866 |
tacaatacaccaaatggtaggacccctattctcggaccctgcacatgcgagagctttagtgca |
43921804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #100
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 224 - 317
Target Start/End: Original strand, 5549582 - 5549677
Alignment:
| Q |
224 |
aaaacagggtaaggctgcgtacaatacacc---aaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|||||||||||| |||||| |||||||||| ||||| ||||||||||| | |||| |||| ||||| |||||| |||| || | ||||||||||| |
|
|
| T |
5549582 |
aaaacagggtaaagctgcgcacaatacaccaaaaaatgatgggacccctttctggactctgcctatgcaggagctttagtaca-caggttgcccttt |
5549677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #101
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 263 - 317
Target Start/End: Complemental strand, 25554796 - 25554742
Alignment:
| Q |
263 |
gaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|||||||||||| ||||||| ||||||||||| ||||||||||| |||||||| |
|
|
| T |
25554796 |
gaccccttcccgaaccctgcgtatgcgggagcattagtgcaccggactgcccttt |
25554742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #102
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 224 - 265
Target Start/End: Original strand, 46859131 - 46859173
Alignment:
| Q |
224 |
aaaacagggtaaggctgcgtacaatacacc-aaatggtgggac |
265 |
Q |
| |
|
||||||||||||| |||||||||||||||| |||||||||||| |
|
|
| T |
46859131 |
aaaacagggtaagactgcgtacaatacaccaaaatggtgggac |
46859173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #103
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 165 - 249
Target Start/End: Complemental strand, 49722726 - 49722641
Alignment:
| Q |
165 |
agttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaa-aacagggtaaggctgcgtacaata |
249 |
Q |
| |
|
||||||||||| |||| | |||||||||||||| ||||| || ||||| |||||||| || || |||||||| ||||||||||| |
|
|
| T |
49722726 |
agttgttgtcacgtgaatgaaaggtcacgggtttaagtcatgtaaacaacctcttgtaaaataatagggtaagattgcgtacaata |
49722641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #104
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 226 - 270
Target Start/End: Original strand, 10158266 - 10158310
Alignment:
| Q |
226 |
aacagggtaaggctgcgtacaatacaccaaatggtgggacccctt |
270 |
Q |
| |
|
||||| |||| ||| |||||||||||||||||||||| ||||||| |
|
|
| T |
10158266 |
aacagagtaatgctacgtacaatacaccaaatggtggcacccctt |
10158310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #105
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 142 - 202
Target Start/End: Original strand, 21006125 - 21006185
Alignment:
| Q |
142 |
ggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagt |
202 |
Q |
| |
|
|||||||||| ||| || |||||| ||||||||||| |||| |||||||| ||||||||| |
|
|
| T |
21006125 |
ggtaaccttgacgcaaccggtaaaattgttgtcatgcgactgaaaggtcaaaggttcaagt |
21006185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 164; Significance: 2e-87; HSPs: 66)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 164; E-Value: 2e-87
Query Start/End: Original strand, 138 - 317
Target Start/End: Complemental strand, 12670429 - 12670250
Alignment:
| Q |
138 |
gaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaagg |
237 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
12670429 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaacagggtaagg |
12670330 |
T |
 |
| Q |
238 |
ctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
12670329 |
ctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttacccttt |
12670250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 161; E-Value: 1e-85
Query Start/End: Original strand, 137 - 317
Target Start/End: Complemental strand, 30454277 - 30454097
Alignment:
| Q |
137 |
tgaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaag |
236 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |||||| |
|
|
| T |
30454277 |
tgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaacaaggtaag |
30454178 |
T |
 |
| Q |
237 |
gctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30454177 |
gctgcgtacgatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
30454097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 139; E-Value: 2e-72
Query Start/End: Original strand, 137 - 322
Target Start/End: Original strand, 13160655 - 13160841
Alignment:
| Q |
137 |
tgaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa-cagggtaa |
235 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
13160655 |
tgaggggtaacctcggcgcaactggtaaagttgttgtcatgtgactgtaaggtcacgggttcaagtcctagaaacagcctcttgtgtaaaaacagggtaa |
13160754 |
T |
 |
| Q |
236 |
ggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttaatgt |
322 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
13160755 |
ggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagcttcagtgcgccgggttgccctttaatgt |
13160841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 136; E-Value: 1e-70
Query Start/End: Original strand, 137 - 317
Target Start/End: Complemental strand, 28817808 - 28817626
Alignment:
| Q |
137 |
tgaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggta |
234 |
Q |
| |
|
|||||||||||||||| || |||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||| ||||||| |
|
|
| T |
28817808 |
tgaggggtaaccttggtgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggta |
28817709 |
T |
 |
| Q |
235 |
aggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||| ||||||| ||||||||||||| |
|
|
| T |
28817708 |
aggctgcgtacaatacacccaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcatcgggttgcccttt |
28817626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 136; E-Value: 1e-70
Query Start/End: Original strand, 137 - 317
Target Start/End: Original strand, 36720749 - 36720931
Alignment:
| Q |
137 |
tgaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||| ||||||| |
|
|
| T |
36720749 |
tgaggggtaaccttggcgtaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggta |
36720848 |
T |
 |
| Q |
235 |
aggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||| ||||||||| ||||||||||| |
|
|
| T |
36720849 |
aggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcggaagctttagtgcacccggttgcccttt |
36720931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 132; E-Value: 3e-68
Query Start/End: Original strand, 138 - 322
Target Start/End: Original strand, 44530103 - 44530289
Alignment:
| Q |
138 |
gaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaa |
235 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| ||||||||||||| ||||||||||||||||||| || ||||| |||||||||||||| |||||||| |
|
|
| T |
44530103 |
gaggggtaaccttggcgcaactggtaaagttgctgtcatgtgactagaaggtcacgggttcaagtcttggaaacaacctcttgtgtaaaaaacagggtaa |
44530202 |
T |
 |
| Q |
236 |
ggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttaatgt |
322 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||| ||||||||||||||| ||||| |||| |
|
|
| T |
44530203 |
ggctgcgtacaatacaccaaatggtgggaccccttcctggaccctgcgtatgcgggagctttagtgcaccgggttgaccttttatgt |
44530289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 131; E-Value: 1e-67
Query Start/End: Original strand, 138 - 317
Target Start/End: Original strand, 35261633 - 35261814
Alignment:
| Q |
138 |
gaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaa |
235 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||| |||| |||||| ||||||||||||| |||||||| |
|
|
| T |
35261633 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagccctggaaacagtctcttgtgtaaaaaacagggtaa |
35261732 |
T |
 |
| Q |
236 |
ggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||| ||||||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
35261733 |
ggttgcgtacaatacaccaaatggtgggaccccttcctggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
35261814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 131; E-Value: 1e-67
Query Start/End: Original strand, 137 - 317
Target Start/End: Complemental strand, 39461178 - 39460994
Alignment:
| Q |
137 |
tgaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggta |
234 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||| |||| ||||||||||||||||||||||| |||||||||||||||| ||||||| ||| |
|
|
| T |
39461178 |
tgaggggtaaccttggcgcaactggtaaagttgttgtcatgagactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagagta |
39461079 |
T |
 |
| Q |
235 |
aggctgcgtacaatacacca--aatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|||||||||||||||||||| ||||||| |||||||||||||||||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
39461078 |
aggctgcgtacaatacaccaataatggtgagaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
39460994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 128; E-Value: 6e-66
Query Start/End: Original strand, 138 - 316
Target Start/End: Original strand, 45071219 - 45071398
Alignment:
| Q |
138 |
gaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa-cagggtaag |
236 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||| | |||||||||||||||||| ||| |||||||||||||||||||| ||||||||| |
|
|
| T |
45071219 |
gaggggtaaccttggcgatactggtaaagttgttgtcatgtgattgtaaggtcacgggttcaagttctggaaacagcctcttgtgtaaaaacagggtaag |
45071318 |
T |
 |
| Q |
237 |
gctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctt |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
45071319 |
gctgcgtacaatacaccaaatggtgggaccccttcccggaccttgcgtatgcgggagcttcagtgcaccgggttgccctt |
45071398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 126; E-Value: 1e-64
Query Start/End: Original strand, 138 - 317
Target Start/End: Complemental strand, 7136710 - 7136527
Alignment:
| Q |
138 |
gaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaa |
235 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||| ||||||| |||||||||||||| ||||| |||||||||||||| |||||||| |
|
|
| T |
7136710 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcatgggttcaagtcctggaaacaacctcttgtgtaaaaaccagggtaa |
7136611 |
T |
 |
| Q |
236 |
ggctgcgtacaatacacca--aatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
7136610 |
ggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttacccttt |
7136527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 125; E-Value: 4e-64
Query Start/End: Original strand, 137 - 318
Target Start/End: Original strand, 17823529 - 17823712
Alignment:
| Q |
137 |
tgaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggta |
234 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||| |||| || |
|
|
| T |
17823529 |
tgaggggtaatcttggcgcaactggtaaagttgttgtcatgtgaccgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaccaggata |
17823628 |
T |
 |
| Q |
235 |
aggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttta |
318 |
Q |
| |
|
|| ||||||| ||||||||||||||||| ||||||||||| ||||||||||||| |||||| |||||||||||||||||||||| |
|
|
| T |
17823629 |
agactgcgtaaaatacaccaaatggtggaaccccttcccgaaccctgcatatgcaggagctttagtgcaccgggttgcccttta |
17823712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 123; E-Value: 6e-63
Query Start/End: Original strand, 137 - 317
Target Start/End: Original strand, 6760776 - 6760959
Alignment:
| Q |
137 |
tgaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggta |
234 |
Q |
| |
|
||||||||||| ||||||| |||||||||||||||||||| |||||| |||||||||||||||||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
6760776 |
tgaggggtaac-ttggcgcaactggtaaagttgttgtcatatgactagaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggta |
6760874 |
T |
 |
| Q |
235 |
aggctgcgtacaatacacca--aatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||||| ||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
6760875 |
aggcttcgtacaatacaccaataatggtgggaccccttctcggaccccgcatatgcgggagctttagtgcaccgggttgcccttt |
6760959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 122; E-Value: 2e-62
Query Start/End: Original strand, 138 - 294
Target Start/End: Complemental strand, 20869677 - 20869523
Alignment:
| Q |
138 |
gaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaagg |
237 |
Q |
| |
|
||||| |||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
20869677 |
gagggataaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaacagggtaagg |
20869578 |
T |
 |
| Q |
238 |
ctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagc |
294 |
Q |
| |
|
||| |||||||||||||| |||| |||||||||||||||||||||||||||||||| |
|
|
| T |
20869577 |
ctgtgtacaatacaccaa--ggtgagaccccttcccggaccctgcatatgcgggagc |
20869523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 119; E-Value: 1e-60
Query Start/End: Original strand, 138 - 317
Target Start/End: Complemental strand, 29521866 - 29521685
Alignment:
| Q |
138 |
gaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaa |
235 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||||| ||||||| |||||||||||||||||||||| |||||||||||||| ||||| |||||||| |
|
|
| T |
29521866 |
gaggggtaaccttggcgcaactgataaagttgttgtcgtgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtttaaaaaacagggtaa |
29521767 |
T |
 |
| Q |
236 |
ggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
||||||||||||||||||||||||||||| ||| |||| |||||||| |||||||||||| |||||||||||||||| |||| |
|
|
| T |
29521766 |
ggctgcgtacaatacaccaaatggtgggaacccatcccagaccctgcgtatgcgggagctttagtgcaccgggttgctcttt |
29521685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 118; E-Value: 6e-60
Query Start/End: Original strand, 137 - 317
Target Start/End: Original strand, 2626472 - 2626657
Alignment:
| Q |
137 |
tgaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt-----aaaacagg |
231 |
Q |
| |
|
||||||||||||||||||| | ||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||| |||||||| |
|
|
| T |
2626472 |
tgaggggtaaccttggcgcaattggtaaagttgttgtcatgtgaccgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaaaaacagg |
2626571 |
T |
 |
| Q |
232 |
gtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
||||| ||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||| |||||||| | ||||||||| |
|
|
| T |
2626572 |
gtaagactgcgtacaatacaccaaatgatgggaccccttcccagaccctgcatatgcgggagcttcagtgcaccagattgcccttt |
2626657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 114; E-Value: 1e-57
Query Start/End: Original strand, 137 - 313
Target Start/End: Complemental strand, 18164941 - 18164764
Alignment:
| Q |
137 |
tgaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt-aaaacagggtaa |
235 |
Q |
| |
|
|||||||||| |||||||| || ||| ||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||| |||||||||||| |
|
|
| T |
18164941 |
tgaggggtaatcttggcgcaaccggtgaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaacagggtaa |
18164842 |
T |
 |
| Q |
236 |
ggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcc |
313 |
Q |
| |
|
|| |||||||||||||||||| | || |||| |||||||||||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
18164841 |
ggttgcgtacaatacaccaaaggatgtgaccatttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcc |
18164764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 112; E-Value: 2e-56
Query Start/End: Original strand, 138 - 317
Target Start/End: Original strand, 26954086 - 26954270
Alignment:
| Q |
138 |
gaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt---aaaacagggta |
234 |
Q |
| |
|
|||||||||| |||||| | |||||||||||||||||||||| || |||||||||||||||||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
26954086 |
gaggggtaactttggcgtaattggtaaagttgttgtcatgtgattagaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaaacagggta |
26954185 |
T |
 |
| Q |
235 |
aggctgcgtacaatacacca--aatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||| |||| ||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
26954186 |
aggctgcgtacaatacaccaataatggtgggaccccttcccagacctcgcatatgcgggagctttagtgcactgggttgcccttt |
26954270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 108; E-Value: 5e-54
Query Start/End: Original strand, 142 - 311
Target Start/End: Complemental strand, 20284250 - 20284075
Alignment:
| Q |
142 |
ggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt----aaaacagggtaagg |
237 |
Q |
| |
|
|||||||||| ||| || ||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||| | |||| ||||||||| |
|
|
| T |
20284250 |
ggtaaccttgacgcaacgggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtataaaaaaaaaagggtaagg |
20284151 |
T |
 |
| Q |
238 |
ctgcgtacaatacacca--aatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttg |
311 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||| |||||||||| | ||||||||||||||| |
|
|
| T |
20284150 |
ctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagttttagtgcaccgggttg |
20284075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 106; E-Value: 9e-53
Query Start/End: Original strand, 143 - 317
Target Start/End: Complemental strand, 8897940 - 8897764
Alignment:
| Q |
143 |
gtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaaca--gggtaaggctg |
240 |
Q |
| |
|
|||||| |||| | ||||||||||||||||||||||||| ||||||||||||| |||||||| ||||| || ||||||||||| | |||||||||| |
|
|
| T |
8897940 |
gtaaccctggcacaactggtaaagttgttgtcatgtgacagcaaggtcacgggttgaagtcctggaaacaaccgcttgtgtaaaaaatagggtaaggcta |
8897841 |
T |
 |
| Q |
241 |
cgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||| ||||||||||| |
|
|
| T |
8897840 |
cgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttactgcacccggttgcccttt |
8897764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 106; E-Value: 9e-53
Query Start/End: Original strand, 142 - 311
Target Start/End: Complemental strand, 21070879 - 21070703
Alignment:
| Q |
142 |
ggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaaca-----gggtaag |
236 |
Q |
| |
|
|||||||||| ||| || ||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||| ||||| | ||||||| |
|
|
| T |
21070879 |
ggtaaccttgacgcaacgggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtataaaaaaaaaaagggtaag |
21070780 |
T |
 |
| Q |
237 |
gctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttg |
311 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||| | ||||||||||||||| |
|
|
| T |
21070779 |
gctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagttttagtgcaccgggttg |
21070703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 103; E-Value: 5e-51
Query Start/End: Original strand, 137 - 317
Target Start/End: Original strand, 25250475 - 25250659
Alignment:
| Q |
137 |
tgaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggta |
234 |
Q |
| |
|
|||| |||||||||||| | |||||||||||||||||||||||||| |||||||| |||||||||||| ||||||||| |||||| |||| |||||| |
|
|
| T |
25250475 |
tgagaggtaaccttggcacaactggtaaagttgttgtcatgtgactggaaggtcacatgttcaagtcctggaaacagcctattgtgtaaaaaatagggta |
25250574 |
T |
 |
| Q |
235 |
aggctgcgtacaatacacca--aatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| |||| ||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
25250575 |
tggctgcgtacaatacaccaataatggtgggaccccttcccgaaccccgcatatgcgggagatttagtgcaccgggttgcccttt |
25250659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 102; E-Value: 2e-50
Query Start/End: Original strand, 157 - 317
Target Start/End: Original strand, 12625862 - 12626025
Alignment:
| Q |
157 |
actggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa---cagggtaaggctgcgtacaatacacc |
253 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||||||| |||||||||| ||||| |||||||||||||| ||||||||| |||| ||||||||||| |
|
|
| T |
12625862 |
actggtaaagttgttgtcgtgtgacttgtaggtcacgggctcaagtcctggaaacaacctcttgtgtaaaaaaacagggtaagactgcatacaatacacc |
12625961 |
T |
 |
| Q |
254 |
aaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
||||||||||||||| ||||||||||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
12625962 |
aaatggtgggaccccctcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
12626025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 96; E-Value: 8e-47
Query Start/End: Original strand, 161 - 295
Target Start/End: Complemental strand, 24365218 - 24365081
Alignment:
| Q |
161 |
gtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa---cagggtaaggctgcgtacaatacaccaaat |
257 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||| ||| |||||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
24365218 |
gtaaagttgttgtcatgtgactaaaatgtcacgggttcaagccctagaaacagcctcttgtgtaaaaaatcagggtaaggctgcgaacaatacaccaaat |
24365119 |
T |
 |
| Q |
258 |
ggtgggaccccttcccggaccctgcatatgcgggagct |
295 |
Q |
| |
|
||||||||||||||||||||||||| |||| ||||||| |
|
|
| T |
24365118 |
ggtgggaccccttcccggaccctgcgtatgtgggagct |
24365081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 93; E-Value: 5e-45
Query Start/End: Original strand, 166 - 317
Target Start/End: Original strand, 31457155 - 31457307
Alignment:
| Q |
166 |
gttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaac-agggtaaggctgcgtacaatacaccaaatggtggga |
264 |
Q |
| |
|
|||||||||||||| || ||||||||||||||||||||||| ||||| |||||||||||||| ||| |||||||||||||||||| |||||||| ||| |
|
|
| T |
31457155 |
gttgttgtcatgtggctgaaaggtcacgggttcaagtcctgtaaacaacctcttgtgtaaaaataggaaaaggctgcgtacaatacatcaaatggtagga |
31457254 |
T |
 |
| Q |
265 |
ccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
||||||||| ||||||| |||||||||||||||||||||||| ||||||||| |
|
|
| T |
31457255 |
ccccttcccaaaccctgcgtatgcgggagctctagtgcaccggattgcccttt |
31457307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 91; E-Value: 8e-44
Query Start/End: Original strand, 147 - 317
Target Start/End: Original strand, 28407379 - 28407538
Alignment:
| Q |
147 |
ccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt-aaaacagggtaaggctgcgtac |
245 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
28407379 |
ccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaacagggtaagg-------- |
28407470 |
T |
 |
| Q |
246 |
aatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||| | |||||||||||| || |||||||||||||||||| |
|
|
| T |
28407471 |
----caccaaatggtgggaccccttcccggaccctacgtatgcgggagctttactgcaccgggttgcccttt |
28407538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 86; E-Value: 7e-41
Query Start/End: Original strand, 208 - 317
Target Start/End: Original strand, 19729366 - 19729475
Alignment:
| Q |
208 |
aaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgg |
307 |
Q |
| |
|
|||||| ||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| || |
|
|
| T |
19729366 |
aaacagtctcttatgtaaaacagggtaaggctgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatacgggagctctagtgcactgg |
19729465 |
T |
 |
| Q |
308 |
gttgcccttt |
317 |
Q |
| |
|
||||||||| |
|
|
| T |
19729466 |
attgcccttt |
19729475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 84; E-Value: 1e-39
Query Start/End: Original strand, 147 - 304
Target Start/End: Complemental strand, 44781677 - 44781517
Alignment:
| Q |
147 |
ccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaa--acagggtaaggctgcgta |
244 |
Q |
| |
|
||||||||| || |||||||||||||||| |||||| |||| |||||||||||||||||| ||||| ||||||||||||| |||||||||||||| ||| |
|
|
| T |
44781677 |
ccttggcgcaac-ggtaaagttgttgtcacgtgactgaaagttcacgggttcaagtcctggaaacaacctcttgtgtaaaagacagggtaaggctgtgta |
44781579 |
T |
 |
| Q |
245 |
caatacacc--aaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcac |
304 |
Q |
| |
|
||||||||| ||||| ||||||||| |||| |||||||| |||||||||||| |||||||| |
|
|
| T |
44781578 |
caatacaccaaaaatgttgggaccccgtcccagaccctgcgtatgcgggagctttagtgcac |
44781517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 83; E-Value: 5e-39
Query Start/End: Original strand, 190 - 317
Target Start/End: Complemental strand, 5135418 - 5135290
Alignment:
| Q |
190 |
cacgggttcaagtcctgaaaacagcctcttgtgtaaaacag--ggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatg |
287 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||| || |||||||||| ||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
5135418 |
cacgggttcaagtcctggaaacagcctcttgtgtaaaaaagagggtaaggctgtgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatg |
5135319 |
T |
 |
| Q |
288 |
cgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
| |||||| | |||||||||| |||||||| |
|
|
| T |
5135318 |
caggagct-ttgtgcaccgggctgcccttt |
5135290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 80; E-Value: 3e-37
Query Start/End: Original strand, 138 - 295
Target Start/End: Original strand, 24245405 - 24245562
Alignment:
| Q |
138 |
gaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaagg |
237 |
Q |
| |
|
||||||||||||||| || |||||||||||||||||||||||||| ||||||||||||||||||||||| |||| | ||||| ||| ||||||||||| |
|
|
| T |
24245405 |
gaggggtaaccttggggcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaac-gtctcttatgt--aacagggtaaga |
24245501 |
T |
 |
| Q |
238 |
ctgcgtacaatacacc---aaatggtgggaccccttcccggaccctgcatatgcgggagct |
295 |
Q |
| |
|
|| |||||||| |||| |||| |||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
24245502 |
ctacgtacaatgcaccaaaaaattgtgggaccccttcctggaccctgcgtatgcgggagct |
24245562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 78; E-Value: 4e-36
Query Start/End: Original strand, 202 - 317
Target Start/End: Original strand, 20869941 - 20870060
Alignment:
| Q |
202 |
tcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctct |
297 |
Q |
| |
|
||||| |||||| ||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||| |||||| ||||||||||||||| | |
|
|
| T |
20869941 |
tcctggaaacagtctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttccaggaccccgcatatgcgggagcttt |
20870040 |
T |
 |
| Q |
298 |
agtgcaccgggttgcccttt |
317 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
20870041 |
agtgcaccgggttgcccttt |
20870060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 78; E-Value: 4e-36
Query Start/End: Original strand, 201 - 315
Target Start/End: Original strand, 29877111 - 29877227
Alignment:
| Q |
201 |
gtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctcta |
298 |
Q |
| |
|
|||||| ||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| || |
|
|
| T |
29877111 |
gtcctggaaacagccttttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagcgtta |
29877210 |
T |
 |
| Q |
299 |
gtgcaccgggttgccct |
315 |
Q |
| |
|
||||||| || |||||| |
|
|
| T |
29877211 |
gtgcaccaggctgccct |
29877227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 77; E-Value: 2e-35
Query Start/End: Original strand, 147 - 308
Target Start/End: Complemental strand, 8484109 - 8483947
Alignment:
| Q |
147 |
ccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgta |
244 |
Q |
| |
|
||||||||| || ||||||| |||| || |||||| ||| |||| |||||||||||||| ||||| |||||||||||||| ||||| ||||||||||| |
|
|
| T |
8484109 |
ccttggcgcaac-ggtaaagcggttgccacgtgacttaaatgtcatgggttcaagtcctggaaacaacctcttgtgtaaaaaacagggcaaggctgcgta |
8484011 |
T |
 |
| Q |
245 |
caatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccggg |
308 |
Q |
| |
|
||||||||||| |||||||||||| |||| |||||||| |||||||||||| ||| |||||||| |
|
|
| T |
8484010 |
caatacaccaattggtgggaccccatcccagaccctgcgtatgcgggagctttagggcaccggg |
8483947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 73; E-Value: 4e-33
Query Start/End: Original strand, 160 - 305
Target Start/End: Original strand, 22598133 - 22598279
Alignment:
| Q |
160 |
ggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaaggctgcgtacaatacaccaaat |
257 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||||||| ||||| ||||| |||||||||| |||||||||||||||| |||||||||||||| | |
|
|
| T |
22598133 |
ggtaaagttgttgtcacatgactgaaaggtcacgggttcaaatcctggaaacaacctcttgtgtaaaaaacagggtaaggctatgtacaatacaccaatt |
22598232 |
T |
 |
| Q |
258 |
ggtgggaccccttcccggaccctgcatatgcgggagctctagtgcacc |
305 |
Q |
| |
|
|||| ||||| |||||||||| ||| ||||||||| || ||||||||| |
|
|
| T |
22598233 |
ggtgagaccctttcccggaccttgcgtatgcggga-ctttagtgcacc |
22598279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 71; E-Value: 7e-32
Query Start/End: Original strand, 184 - 307
Target Start/End: Original strand, 389643 - 389770
Alignment:
| Q |
184 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgt----aaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccc |
279 |
Q |
| |
|
||||||||||||||||||||||| ||||| |||||||||| |||||||||||||| |||||||||||||||||||| ||||| ||||| || ||||| |
|
|
| T |
389643 |
aaaggtcacgggttcaagtcctggaaacaccctcttgtgtcaaaaaaacagggtaaggttgcgtacaatacaccaaatgatgggatccctttcctgaccc |
389742 |
T |
 |
| Q |
280 |
tgcatatgcgggagctctagtgcaccgg |
307 |
Q |
| |
|
||| |||||| ||||| ||||||||||| |
|
|
| T |
389743 |
tgcgtatgcgagagctttagtgcaccgg |
389770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 71; E-Value: 7e-32
Query Start/End: Original strand, 193 - 312
Target Start/End: Original strand, 5689640 - 5689761
Alignment:
| Q |
193 |
gggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgg |
290 |
Q |
| |
|
||||||||||| || ||| |||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||| ||| ||| |||| || |
|
|
| T |
5689640 |
gggttcaagtcttgtaaatagcctcttgtgtaaaaagcagggtaaggctgcgtacaatacaccaaatggtggaaccccttcccgaaccatgcgtatgtgg |
5689739 |
T |
 |
| Q |
291 |
gagctctagtgcaccgggttgc |
312 |
Q |
| |
|
||||| ||||||||||| |||| |
|
|
| T |
5689740 |
gagctttagtgcaccggtttgc |
5689761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 71; E-Value: 7e-32
Query Start/End: Original strand, 170 - 318
Target Start/End: Complemental strand, 23000365 - 23000227
Alignment:
| Q |
170 |
ttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa-cagggtaaggctgcgtacaatacaccaaatggtgggacccc |
268 |
Q |
| |
|
||||||||||||| ||||||||||||| |||||||| |||||||||||||||||||| || ||||||| | | |||||||||||||||||||||||||| |
|
|
| T |
23000365 |
ttgtcatgtgactgaaaggtcacgggt--aagtcctggaaacagcctcttgtgtaaaaacacggtaaggttccatacaatacaccaaatggtgggacccc |
23000268 |
T |
 |
| Q |
269 |
ttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttta |
318 |
Q |
| |
|
||||||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
23000267 |
ttcccgg---------atgcgggagctttagtgcaccgggttgcccttta |
23000227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 71; E-Value: 7e-32
Query Start/End: Original strand, 243 - 317
Target Start/End: Original strand, 26102578 - 26102652
Alignment:
| Q |
243 |
tacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
26102578 |
tacaatacaccaaatggtgggaccccttcccggaccctgcttatgcgggagctctagtgcaccgggttgcccttt |
26102652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 70; E-Value: 3e-31
Query Start/End: Original strand, 147 - 316
Target Start/End: Complemental strand, 42083870 - 42083699
Alignment:
| Q |
147 |
ccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaaca--gggtaaggctgcgta |
244 |
Q |
| |
|
||||||||| || |||||| ||||||||| |||||| ||||||||||||||||||||||| ||||||||| |||||||||| | ||| ||||||||||| |
|
|
| T |
42083870 |
ccttggcgcaac-ggtaaaattgttgtcacgtgactgaaaggtcacgggttcaagtcctggaaacagccttttgtgtaaaaaatggggcaaggctgcgta |
42083772 |
T |
 |
| Q |
245 |
caatacacc-aaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctt |
316 |
Q |
| |
|
|| || ||| ||||||||||||||||||||| |||||| || | ||||||| ||||||| ||| ||||||| |
|
|
| T |
42083771 |
cagtataccaaaatggtgggaccccttcccgaaccctgtgtacgtgggagctttagtgcattgggctgccctt |
42083699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 208 - 317
Target Start/End: Original strand, 10857852 - 10857964
Alignment:
| Q |
208 |
aaacagcctcttgtgtaaaa---cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcac |
304 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||||||| |||||||||||| |||||||||| ||||| ||||| ||| |||||||||||| |||||||| |
|
|
| T |
10857852 |
aaaccgcctcttgtgtaaaaaaacagggtaaggctgcgcacaatacaccaattggtgggaccacttcctggaccttgcgtatgcgggagctttagtgcac |
10857951 |
T |
 |
| Q |
305 |
cgggttgcccttt |
317 |
Q |
| |
|
||||||||||||| |
|
|
| T |
10857952 |
cgggttgcccttt |
10857964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 210 - 318
Target Start/End: Original strand, 16225045 - 16225157
Alignment:
| Q |
210 |
acagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcacc |
305 |
Q |
| |
|
|||||||||| ||||||| ||||||||| |||||||||||||||||| ||||||||| |||||||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
16225045 |
acagcctcttatgtaaaaaacagggtaagactgcgtacaatacaccaataatggtgggatcccttcccggaccccgcatatgcgggagctttagtgcacc |
16225144 |
T |
 |
| Q |
306 |
gggttgcccttta |
318 |
Q |
| |
|
|||||| |||||| |
|
|
| T |
16225145 |
gggttgtccttta |
16225157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 66; E-Value: 6e-29
Query Start/End: Original strand, 163 - 280
Target Start/End: Original strand, 35105902 - 35106022
Alignment:
| Q |
163 |
aaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaa--acagggtaaggctgcgtacaatacacca-aatgg |
259 |
Q |
| |
|
||||||||||||| ||| || ||||||||||||||||||||||| ||||| ||||||||||||| | || ||||||||||||||||||||||| ||||| |
|
|
| T |
35105902 |
aaagttgttgtcacgtggctgaaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaagagagtgtaaggctgcgtacaatacaccagaatgg |
35106001 |
T |
 |
| Q |
260 |
tgggaccccttcccggaccct |
280 |
Q |
| |
|
||||||| ||||| ||||||| |
|
|
| T |
35106002 |
tgggacctcttcctggaccct |
35106022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 139 - 288
Target Start/End: Original strand, 11748254 - 11748407
Alignment:
| Q |
139 |
aggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaag |
236 |
Q |
| |
|
||||||||| |||| || |||||| || |||||||||||||||| ||| |||||||||||||||| || |||||||||||| ||||||| ||||||||| |
|
|
| T |
11748254 |
aggggtaactttggtgcaactggtgaaattgttgtcatgtgactgaaatgtcacgggttcaagtcttggaaacagcctcttttgtaaaaagcagggtaag |
11748353 |
T |
 |
| Q |
237 |
gctgcgtaca--atacaccaaatggtgggaccccttcccggaccctgcatatgc |
288 |
Q |
| |
|
| ||||||| ||||| ||||||| ||||||||||||| | ||||||||||| |
|
|
| T |
11748354 |
acagcgtacaatatacaaaaaatggtaggaccccttcccgaatcctgcatatgc |
11748407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #43
Raw Score: 61; E-Value: 6e-26
Query Start/End: Original strand, 160 - 295
Target Start/End: Complemental strand, 11001109 - 11000971
Alignment:
| Q |
160 |
ggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa---cagggtaaggctgcgtacaatacaccaaa |
256 |
Q |
| |
|
||||||||||||||||||||| | ||||||| ||||||||| | ||||||||| ||| ||||||||| || | |||||||| ||||||||||||||| |
|
|
| T |
11001109 |
ggtaaagttgttgtcatgtgattgaaaggtcgcgggttcaaattctgaaaacaacctactgtgtaaaaaaacaagataaggctgtgtacaatacaccaaa |
11001010 |
T |
 |
| Q |
257 |
tggtgggaccccttcccggaccctgcatatgcgggagct |
295 |
Q |
| |
|
||||||||||||| |||| |||||| ||||| |||||| |
|
|
| T |
11001009 |
tggtgggacccctacccgaaccctgtttatgcaggagct |
11000971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #44
Raw Score: 61; E-Value: 6e-26
Query Start/End: Original strand, 147 - 295
Target Start/End: Complemental strand, 14018140 - 14017990
Alignment:
| Q |
147 |
ccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaaggctgcgta |
244 |
Q |
| |
|
||||||||| || ||||| |||||||||| |||| | |||||||| ||||||||||| || |||||| ||||||||| |||||||||| || ||||||| |
|
|
| T |
14018140 |
ccttggcgcaac-ggtaatgttgttgtcacgtgattgaaaggtcatgggttcaagtcttggaaacagtctcttgtgtaaaaaacagggtgagactgcgta |
14018042 |
T |
 |
| Q |
245 |
caatacaccaaa-tggtgggaccccttcccggaccctgcatatgcgggagct |
295 |
Q |
| |
|
|||||||| ||| |||||||||| ||||| |||||||||| |||||| |||| |
|
|
| T |
14018041 |
caatacactaaattggtgggaccacttcctggaccctgcagatgcggtagct |
14017990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #45
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 210 - 318
Target Start/End: Complemental strand, 23286432 - 23286336
Alignment:
| Q |
210 |
acagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggt |
309 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
23286432 |
acagcctcttgtgtaaaacagggtaaagctgcgtacaatacaccaaatggtggg------------accctgcatatgcgggagctctagtgcaccgggc |
23286345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #46
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 139 - 314
Target Start/End: Complemental strand, 44742698 - 44742521
Alignment:
| Q |
139 |
aggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaag |
236 |
Q |
| |
|
||||| |||||||| || || ||||||||||||||| |||| | ||||||| | |||||||| ||| ||||| ||| ||||||||| ||||||||| |
|
|
| T |
44742698 |
agggggaaccttggtgcaac-ggtaaagttgttgtcgcgtgattgtaaggtcatgagttcaagttctggaaacaatctcctgtgtaaaaaacagggtaag |
44742600 |
T |
 |
| Q |
237 |
gctgcgtacaatacacc-aaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccc |
314 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| ||||||| | |||||||||| |||||||||||| ||||| |
|
|
| T |
44742599 |
gctgcgtacaatacaccaaaatggtgggaccccttcttggaccctacggatgcgggagcattagtgcaccggggtgccc |
44742521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #47
Raw Score: 54; E-Value: 9e-22
Query Start/End: Original strand, 195 - 314
Target Start/End: Complemental strand, 17251001 - 17250879
Alignment:
| Q |
195 |
gttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgg |
290 |
Q |
| |
|
|||||||||||| || ||||||||||||||||| |||| |||||| |||||||||||||||| |||||||||||| |||||| ||||||| |||| | |
|
|
| T |
17251001 |
gttcaagtcctggaagcagcctcttgtgtaaaaaacaggttaaggcagcgtacaatacaccaataatggtgggaccctttcccgaaccctgcgtatgaag |
17250902 |
T |
 |
| Q |
291 |
gagctctagtgcaccgggttgccc |
314 |
Q |
| |
|
||||| ||||||| |||||||||| |
|
|
| T |
17250901 |
gagctttagtgca-cgggttgccc |
17250879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #48
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 137 - 317
Target Start/End: Complemental strand, 40605087 - 40604906
Alignment:
| Q |
137 |
tgaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaaca--gggta |
234 |
Q |
| |
|
||||||||||| ||||||| |||||||||||||||||||||||| | | | | | ||||||||||| || ||||| || |||||||||| | || || |
|
|
| T |
40605087 |
tgaggggtaactttggcgcaactggtaaagttgttgtcatgtgattggatgattatgggttcaagtcatggaaacaatcttttgtgtaaaaaattggata |
40604988 |
T |
 |
| Q |
235 |
aggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
||| |||||||||||||| ||||| | ||| ||||||| ||||| | |||||||||||| |||||||||| ||||||||| |
|
|
| T |
40604987 |
aggttgcgtacaatacactaaatgat-ggatcccttccgaaaccctacgtatgcgggagctttagtgcaccgaattgcccttt |
40604906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #49
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 229 - 310
Target Start/End: Original strand, 26457776 - 26457855
Alignment:
| Q |
229 |
agggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggtt |
310 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||| || |||| ||| |||| ||||||| |||||||||||||| |
|
|
| T |
26457776 |
agggtaaggctgcgtacaatacaccaattggtgggacccct--cctgaccttgcgtatgagggagctttagtgcaccgggtt |
26457855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #50
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 239 - 317
Target Start/End: Original strand, 16013511 - 16013591
Alignment:
| Q |
239 |
tgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|||||||||||||| ||| ||||| ||||||||||| |||||||| |||||||||||| ||||||||||||||| ||||| |
|
|
| T |
16013511 |
tgcgtacaatacactaaaaatggtgcgaccccttcccagaccctgcctatgcgggagctttagtgcaccgggttgtccttt |
16013591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #51
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 163 - 227
Target Start/End: Complemental strand, 30962929 - 30962865
Alignment:
| Q |
163 |
aaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa |
227 |
Q |
| |
|
|||||||||||||||||| | |||||||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
30962929 |
aaagttgttgtcatgtgattgaaaggtcacgacttcaagtcctggaaacagcctcttgtgtaaaa |
30962865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #52
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 207 - 273
Target Start/End: Original strand, 43942347 - 43942417
Alignment:
| Q |
207 |
aaaacagcctcttgtgt--aaaacagggtaaggctgcgtacaatacacc--aaatggtgggaccccttccc |
273 |
Q |
| |
|
||||||||||||| ||| |||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
43942347 |
aaaacagcctcttatgtcaaaaacagggtaaggctgcgtacaatacaccaaaaatggtgggaccccttccc |
43942417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #53
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 257 - 316
Target Start/End: Original strand, 27507985 - 27508044
Alignment:
| Q |
257 |
tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctt |
316 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||||||||| ||||||||||||||| |||| |
|
|
| T |
27507985 |
tggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgtcctt |
27508044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #54
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 254 - 317
Target Start/End: Complemental strand, 35107374 - 35107311
Alignment:
| Q |
254 |
aaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|||||||||||||||||||||||| ||| ||||||| |||| ||||||||||||||||||||| |
|
|
| T |
35107374 |
aaatggtgggaccccttcccggacgctgtgtatgcggaagctttagtgcaccgggttgcccttt |
35107311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #55
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 268 - 317
Target Start/End: Complemental strand, 27468141 - 27468092
Alignment:
| Q |
268 |
cttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
||||||||||||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
27468141 |
cttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
27468092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #56
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 192 - 318
Target Start/End: Original strand, 33866957 - 33867088
Alignment:
| Q |
192 |
cgggttcaagtcctgaaaacagcctcttgtgtaaaa---cagggtaaggctgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcatat |
286 |
Q |
| |
|
|||||||||||||| |||||| | | |||||||||| ||||||||| |||| ||||||||| ||| ||||| || ||||||| ||||||| ||| |
|
|
| T |
33866957 |
cgggttcaagtcctaaaaacaactttttgtgtaaaaaagcagggtaagactgcatacaatacataaaaaatggtgacacttcttcccgaaccctgcgtat |
33867056 |
T |
 |
| Q |
287 |
gcgggagctctagtgcaccgggttgcccttta |
318 |
Q |
| |
|
|| | |||| |||||||||||||||||||||| |
|
|
| T |
33867057 |
gcagaagctttagtgcaccgggttgcccttta |
33867088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #57
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 137 - 181
Target Start/End: Complemental strand, 23286475 - 23286431
Alignment:
| Q |
137 |
tgaggggtaaccttggcgccactggtaaagttgttgtcatgtgac |
181 |
Q |
| |
|
||||||||||||||| ||| ||||||||||||||||||||||||| |
|
|
| T |
23286475 |
tgaggggtaaccttgtcgcaactggtaaagttgttgtcatgtgac |
23286431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #58
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 256 - 316
Target Start/End: Complemental strand, 36486627 - 36486567
Alignment:
| Q |
256 |
atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctt |
316 |
Q |
| |
|
||||||||||| ||||||||||| ||| ||||| |||||| |||||| ||||||||||||| |
|
|
| T |
36486627 |
atggtgggacctcttcccggaccttgcgtatgcaggagctttagtgccccgggttgccctt |
36486567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #59
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 228 - 303
Target Start/End: Complemental strand, 30231420 - 30231344
Alignment:
| Q |
228 |
cagggtaaggctgcgtacaatacaccaaa-tggtgggaccccttcccggaccctgcatatgcgggagctctagtgca |
303 |
Q |
| |
|
|||| ||||||||||||||||| |||||| ||||||||||| | |||| ||||| |||| | ||||||| ||||||| |
|
|
| T |
30231420 |
caggataaggctgcgtacaatataccaaaatggtgggacccttacccgaaccctccatacgtgggagctttagtgca |
30231344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #60
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 140 - 212
Target Start/End: Original strand, 31454144 - 31454216
Alignment:
| Q |
140 |
ggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaaca |
212 |
Q |
| |
|
||||||| |||||||| || |||| ||||||||||||||| | ||||||||| ||||| |||||||||||| |
|
|
| T |
31454144 |
ggggtaatcttggcgcaaccggtatagttgttgtcatgtggttgaaaggtcacatgttcatgtcctgaaaaca |
31454216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #61
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 262 - 313
Target Start/End: Original strand, 18595918 - 18595969
Alignment:
| Q |
262 |
ggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcc |
313 |
Q |
| |
|
|||||||||||||||||||| |||||||||| | ||||||| ||||||||| |
|
|
| T |
18595918 |
ggaccccttcccggaccctgtgtatgcgggagttttagtgcatcgggttgcc |
18595969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #62
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 162 - 257
Target Start/End: Original strand, 36918102 - 36918199
Alignment:
| Q |
162 |
taaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaat |
257 |
Q |
| |
|
|||| ||||||| ||| ||| ||||||||| |||||||| ||| ||||| |||| ||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
36918102 |
taaaattgttgttatggaactgaaaggtcacatgttcaagttctggaaacaatttcttatgtaaaaaacagggtaaggctgtgtacaatacaccaaat |
36918199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #63
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 273 - 318
Target Start/End: Complemental strand, 30962815 - 30962770
Alignment:
| Q |
273 |
cggaccctgcatatgcgggagctctagtgcaccgggttgcccttta |
318 |
Q |
| |
|
|||||||||| |||||||||| | ||||| |||||||||||||||| |
|
|
| T |
30962815 |
cggaccctgcgtatgcgggagatttagtgaaccgggttgcccttta |
30962770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #64
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 138 - 175
Target Start/End: Original strand, 42840863 - 42840900
Alignment:
| Q |
138 |
gaggggtaaccttggcgccactggtaaagttgttgtca |
175 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
42840863 |
gaggggtaaccttggcgcaactagtaaagttgttgtca |
42840900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #65
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 256 - 288
Target Start/End: Original strand, 12483584 - 12483616
Alignment:
| Q |
256 |
atggtgggaccccttcccggaccctgcatatgc |
288 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |
|
|
| T |
12483584 |
atggtgggaccccttcccggaccctacatatgc |
12483616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #66
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 261 - 317
Target Start/End: Original strand, 40444845 - 40444901
Alignment:
| Q |
261 |
gggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|||||||||| ||||||||||| |||| |||||| |||||||||| | |||||||| |
|
|
| T |
40444845 |
gggaccccttgccggaccctgcgtatgttggagctttagtgcaccgagctgcccttt |
40444901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 164; Significance: 2e-87; HSPs: 85)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 164; E-Value: 2e-87
Query Start/End: Original strand, 138 - 317
Target Start/End: Complemental strand, 21172188 - 21172009
Alignment:
| Q |
138 |
gaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaagg |
237 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||| ||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
21172188 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtaactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaacagggtaagg |
21172089 |
T |
 |
| Q |
238 |
ctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21172088 |
ctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
21172009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 161; E-Value: 1e-85
Query Start/End: Original strand, 137 - 317
Target Start/End: Original strand, 32758214 - 32758394
Alignment:
| Q |
137 |
tgaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaag |
236 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||| ||||||||| ||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
32758214 |
tgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacaggttcaagtcctggaaacagcctcttgtgtaaaacagggtaag |
32758313 |
T |
 |
| Q |
237 |
gctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32758314 |
gctgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
32758394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 155; E-Value: 5e-82
Query Start/End: Original strand, 137 - 318
Target Start/End: Complemental strand, 48735303 - 48735121
Alignment:
| Q |
137 |
tgaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcct-gaaaacagcctcttgtgtaaaacagggtaa |
235 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||| | ||||| |||||||||||||||| ||||| |
|
|
| T |
48735303 |
tgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtccttggaaacaacctcttgtgtaaaacacggtaa |
48735204 |
T |
 |
| Q |
236 |
ggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttta |
318 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48735203 |
ggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttta |
48735121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 151; E-Value: 1e-79
Query Start/End: Original strand, 145 - 319
Target Start/End: Complemental strand, 10693245 - 10693071
Alignment:
| Q |
145 |
aaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaaggctgcgta |
244 |
Q |
| |
|
||||||||||| ||| |||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||| |
|
|
| T |
10693245 |
aaccttggcgcaactagtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaagagggtaaggctgcgta |
10693146 |
T |
 |
| Q |
245 |
caatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttaa |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
10693145 |
caatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcactgggttgccctttaa |
10693071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 140; E-Value: 4e-73
Query Start/End: Original strand, 166 - 317
Target Start/End: Complemental strand, 42391251 - 42391100
Alignment:
| Q |
166 |
gttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggac |
265 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42391251 |
gttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcttcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggac |
42391152 |
T |
 |
| Q |
266 |
cccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42391151 |
cccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
42391100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 135; E-Value: 4e-70
Query Start/End: Original strand, 137 - 319
Target Start/End: Complemental strand, 2541202 - 2541017
Alignment:
| Q |
137 |
tgaggggtaaccttggcgccactggtaaagttgttgtcatgtgacta-aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggt |
233 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||| |||||| |
|
|
| T |
2541202 |
tgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactggaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggt |
2541103 |
T |
 |
| Q |
234 |
aaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttaa |
319 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||| |||||| |||||||||||| |||||||||||||| |||||||| |
|
|
| T |
2541102 |
aaggctgcgtactatacaccaaatggtgggaccccttcccggtccctgcgtatgcgggagctttagtgcaccgggtttccctttaa |
2541017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 131; E-Value: 1e-67
Query Start/End: Original strand, 138 - 317
Target Start/End: Original strand, 42798623 - 42798804
Alignment:
| Q |
138 |
gaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaa |
235 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||| || |||||| ||||||||||||| || ||||| |
|
|
| T |
42798623 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcttggaaacagtctcttgtgtaaaaaacaaggtaa |
42798722 |
T |
 |
| Q |
236 |
ggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
42798723 |
ggctgcgtacaatacaccaaatggtgggaccctttcccggaccctgcatatgcgggagctatagtgcatcgggttgcccttt |
42798804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 131; E-Value: 1e-67
Query Start/End: Original strand, 137 - 317
Target Start/End: Original strand, 42805477 - 42805661
Alignment:
| Q |
137 |
tgaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
42805477 |
tgaggggtaaccttggcgtaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggta |
42805576 |
T |
 |
| Q |
235 |
aggctgcgtacaatacacca--aatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|||||| ||||||||||||| ||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
42805577 |
aggctgtgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttgcccttt |
42805661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 130; E-Value: 4e-67
Query Start/End: Original strand, 135 - 316
Target Start/End: Original strand, 42476824 - 42477005
Alignment:
| Q |
135 |
tctgaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggta |
234 |
Q |
| |
|
||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||| ||||||| ||| |||||| ||||||||||||||| |||| |
|
|
| T |
42476824 |
tctgaggggtaacattggcgtaactggtaaagttgttgtcatgtgactaaaaggtcacggattcaagttctggaaacagtctcttgtgtaaaacaaggta |
42476923 |
T |
 |
| Q |
235 |
aggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctt |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| | | ||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
42476924 |
aggctgcgtacaatacaccaaatggtgggaccccttcctaggctctgcatatgcgggagctctagtgcaccaggttgccctt |
42477005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 124; E-Value: 2e-63
Query Start/End: Original strand, 138 - 313
Target Start/End: Complemental strand, 47078034 - 47077859
Alignment:
| Q |
138 |
gaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaagg |
237 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||| |||||| ||||||||||||| || |||| | |
|
|
| T |
47078034 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagtctcttgtgtaaaatagagtaaag |
47077935 |
T |
 |
| Q |
238 |
ctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcc |
313 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| ||||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
47077934 |
ttgcgtacaatacacaaaatggtgggaccccttcccaaaccctacatatgcgggagctctagtgcaccggattgcc |
47077859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 123; E-Value: 6e-63
Query Start/End: Original strand, 138 - 318
Target Start/End: Original strand, 47716413 - 47716597
Alignment:
| Q |
138 |
gaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaa |
235 |
Q |
| |
|
|||||||||||||||| | ||||| |||||||||| ||||||||| |||||||||||||||||||||| |||||||||||||||| |||||||||||| |
|
|
| T |
47716413 |
gaggggtaaccttggcacaactggaaaagttgttgccatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaa |
47716512 |
T |
 |
| Q |
236 |
ggctgcgtacaatacacca--aatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttta |
318 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
47716513 |
ggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttggtgcaccgggttgcccttta |
47716597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 119; E-Value: 1e-60
Query Start/End: Original strand, 146 - 317
Target Start/End: Original strand, 27629596 - 27629769
Alignment:
| Q |
146 |
accttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgt |
243 |
Q |
| |
|
|||||||||| |||||||||||||||||||| |||| ||||||||||||||||||||||| |||||||||||||||||||| |||||||||| ||||| |
|
|
| T |
27629596 |
accttggcgcaactggtaaagttgttgtcatttgaccgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggttgcgt |
27629695 |
T |
 |
| Q |
244 |
acaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
| |||||||||||||||||||||||||||||| |||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
27629696 |
aaaatacaccaaatggtgggaccccttcccgggccctgcatatgcggtagcttcagtgcaccgggttgcccttt |
27629769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 118; E-Value: 6e-60
Query Start/End: Original strand, 163 - 316
Target Start/End: Original strand, 11741774 - 11741927
Alignment:
| Q |
163 |
aaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgg |
262 |
Q |
| |
|
|||||||||||||||||||| |||||||| |||||||||||||||||||||| ||| |||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
11741774 |
aaagttgttgtcatgtgactgaaaggtcatgggttcaagtcctgaaaacagcttctagtgtaaaatagggtaaggctgcgtacaatacaccaaatggtgg |
11741873 |
T |
 |
| Q |
263 |
gaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctt |
316 |
Q |
| |
|
|| ||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
11741874 |
gatcccttcccggattctgcacatgcgggagctctagtgcaccgggttgccctt |
11741927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 115; E-Value: 4e-58
Query Start/End: Original strand, 145 - 316
Target Start/End: Complemental strand, 11617762 - 11617589
Alignment:
| Q |
145 |
aaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcg |
242 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||||| ||||||||| ||||||||||||| ||||| |||||||||||||| ||||||||| ||||| |
|
|
| T |
11617762 |
aacctcggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacaggttcaagtcctggaaacaacctcttgtgtaaaaaacagggtaagactgcg |
11617663 |
T |
 |
| Q |
243 |
tacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctt |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||| ||||| ||| || |||||||||||||||||||| |
|
|
| T |
11617662 |
tacaatacaccaaatggtgggaccccttcctggaccctgcgtatgcaggacctttagtgcaccgggttgccctt |
11617589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 115; E-Value: 4e-58
Query Start/End: Original strand, 138 - 317
Target Start/End: Original strand, 43557426 - 43557610
Alignment:
| Q |
138 |
gaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaa |
235 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||||||||||||||| |||||||| |||||||||||||| |||||||||||||||| ||||||| |||| |
|
|
| T |
43557426 |
gaggggtaaccttgccgcaactggtaaagttgttgtcatgtgactgaaaggtcatgggttcaagtcctggaaacagcctcttgtgtaaaaaacagagtaa |
43557525 |
T |
 |
| Q |
236 |
ggctgcgtacaatacacca--aatggtgggaccccttcccggaccctgcatatgcgggagc-tctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||||| |||| ||||||||||| | ||||||||||||||||||||| |
|
|
| T |
43557526 |
ggctgcgtacaatacaccaataatggtgggaccccctcccggactctgcgtatgcgggagcttttagtgcaccgggttgcccttt |
43557610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 114; E-Value: 1e-57
Query Start/End: Original strand, 137 - 317
Target Start/End: Complemental strand, 34626389 - 34626208
Alignment:
| Q |
137 |
tgaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa-cagggtaa |
235 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||||||| | ||||| ||| | ||||||||||| |||||||||| ||||||||| |||||||| |
|
|
| T |
34626389 |
tgaggggtaaccttagcgcaactggtaaagttgttgtcatgtgattgaaaggccacagattcaagtcctggaaacagcctcctgtgtaaaaacagggtaa |
34626290 |
T |
 |
| Q |
236 |
ggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|||||||| |||||||||||||||||||| ||||||||||||||||| |||||||||||| |||| || ||||||||||||| |
|
|
| T |
34626289 |
ggctgcgttcaatacaccaaatggtgggatcccttcccggaccctgcgtatgcgggagctttagttcatcgggttgcccttt |
34626208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 112; E-Value: 2e-56
Query Start/End: Original strand, 149 - 317
Target Start/End: Complemental strand, 19427059 - 19426890
Alignment:
| Q |
149 |
ttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaaggctgcgtaca |
246 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||| |||| |||||||| ||||||||| |
|
|
| T |
19427059 |
ttggcgcaactggtaaagttgttgtcatgtgaccgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaatagggtaagactgcgtaca |
19426960 |
T |
 |
| Q |
247 |
atacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|||||||||||||||||| |||||| ||||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
19426959 |
atacaccaaatggtggga-cccttctcggaccctgcatatgcgagagcttcagtgcaccgggttgcccttt |
19426890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 111; E-Value: 9e-56
Query Start/End: Original strand, 137 - 315
Target Start/End: Complemental strand, 35334996 - 35334818
Alignment:
| Q |
137 |
tgaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaag |
236 |
Q |
| |
|
|||||| |||||||||||| |||||||||||||||||||||||||| ||||||||| |||||||||||| |||||| ||| ||| ||||||||||||| |
|
|
| T |
35334996 |
tgagggataaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacgagttcaagtcctggaaacagtctcgtgtaaaaaacagggtaag |
35334897 |
T |
 |
| Q |
237 |
gctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccct |
315 |
Q |
| |
|
||| |||||||||||| |||||||||||||||||||||||||||| ||||| |||||| |||||||||||||| |||| |
|
|
| T |
35334896 |
actgtgtacaatacaccgaatggtgggaccccttcccggaccctgcgtatgcaggagctttagtgcaccgggtttccct |
35334818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 107; E-Value: 2e-53
Query Start/End: Original strand, 144 - 317
Target Start/End: Original strand, 40463837 - 40464011
Alignment:
| Q |
144 |
taaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa-cagggtaaggctgcg |
242 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||||| ||||||||||||||||||| | |||||| ||||||||||||| | ||||||||||||| |
|
|
| T |
40463837 |
taaccttggcgcaaccggtaaagttgttgtcatgtgactgtaaggtcacgggttcaagtcatagaaacagtctcttgtgtaaaaactgggtaaggctgcg |
40463936 |
T |
 |
| Q |
243 |
tacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|| |||||||||||||||||||||||||| |||||||||| |||||||||||| ||||||||| |||||||||| |
|
|
| T |
40463937 |
tataatacaccaaatggtgggaccccttctcggaccctgcgtatgcgggagcttcagtgcaccgagttgcccttt |
40464011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 106; E-Value: 9e-53
Query Start/End: Original strand, 184 - 317
Target Start/End: Complemental strand, 31591242 - 31591109
Alignment:
| Q |
184 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgca |
283 |
Q |
| |
|
|||||||||| |||||||||||| ||||| ||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
31591242 |
aaaggtcacgagttcaagtcctggaaacaacctcttgtgtaaaacagagtaaggctgcgtacaatacaataaatggtgggaccccttcccggaccttgca |
31591143 |
T |
 |
| Q |
284 |
tatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
31591142 |
tatgcgggagctctagtgcaccgggttgcccttt |
31591109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 106; E-Value: 9e-53
Query Start/End: Original strand, 158 - 318
Target Start/End: Complemental strand, 33872070 - 33871909
Alignment:
| Q |
158 |
ctggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa-cagggtaaggctgcgtacaatacaccaaa |
256 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| ||||||||||||||| ||||| |||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
33872070 |
ctggtaaagttgttgtcatgtgactgaaaggtcgcgggttcaagtcctggaaacaacctcttgtgtaaaaacaggataaggctgcgtacaatacaccaaa |
33871971 |
T |
 |
| Q |
257 |
tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttta |
318 |
Q |
| |
|
||||||||||||||||| ||||||| |||||| ||||| ||||||||| ||||||| |||| |
|
|
| T |
33871970 |
tggtgggaccccttcccagaccctgtgtatgcgagagctttagtgcaccaggttgcctttta |
33871909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 105; E-Value: 3e-52
Query Start/End: Original strand, 138 - 288
Target Start/End: Original strand, 46354148 - 46354302
Alignment:
| Q |
138 |
gaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaa |
235 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||| | |||||||||||||||||||||| ||||| |||||||||| |||||||||||| |
|
|
| T |
46354148 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgattggaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaaaacagggtaa |
46354247 |
T |
 |
| Q |
236 |
ggctgcgtacaatacacca--aatggtgggaccccttcccggaccctgcatatgc |
288 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||| |||||||| |
|
|
| T |
46354248 |
ggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgc |
46354302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 100; E-Value: 3e-49
Query Start/End: Original strand, 138 - 318
Target Start/End: Complemental strand, 22699151 - 22698966
Alignment:
| Q |
138 |
gaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaa |
235 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||||||||||||||| |||||| | |||||||||||||| ||| || ||||||||| |||||||||||| |
|
|
| T |
22699151 |
gaggggtaaccttgacgcaactggtaaagttgttgtcatgtgactgaaaggttatgggttcaagtcctggaaatagtctcttgtgtaaaaaacagggtaa |
22699052 |
T |
 |
| Q |
236 |
ggctgcgtacaatacacc--aaatggtgggaccc-cttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttta |
318 |
Q |
| |
|
| |||||||||||||||| |||||||||||||| ||||||||||||| |||||||||||| |||||||||||||| ||||||| |
|
|
| T |
22699051 |
gactgcgtacaatacaccaaaaatggtgggacccttttcccggaccctgtgtatgcgggagctatagtgcaccgggttacccttta |
22698966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 99; E-Value: 1e-48
Query Start/End: Original strand, 138 - 307
Target Start/End: Complemental strand, 2663112 - 2662946
Alignment:
| Q |
138 |
gaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaagg |
237 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||||| |||||||| | |||| ||||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
2663112 |
gaggggtaaccttggcgcaactagtaaagttgttgttatgtgactgga--gtcataggttcaagtcctggaaacagcctcttgtgtaaaatagggtaagg |
2663015 |
T |
 |
| Q |
238 |
ctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgg |
307 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| | ||||||||||||||||||||||||| ||||||| |
|
|
| T |
2663014 |
ctgcgtacaatacaccaaatggtggga-cccttttcagaccctgcatatgcgggagctctagcgcaccgg |
2662946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 99; E-Value: 1e-48
Query Start/End: Original strand, 160 - 317
Target Start/End: Original strand, 19265791 - 19265948
Alignment:
| Q |
160 |
ggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaac-agggtaaggctgcgtacaatacaccaaatg |
258 |
Q |
| |
|
|||||||||||||||| |||||| |||||||||||||||||||| || | |||||| ||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
19265791 |
ggtaaagttgttgtcacgtgactgaaaggtcacgggttcaagtcttggatacagccgcttgtgtaaaaagagggtaaggctgcgtacaatacaccaaatg |
19265890 |
T |
 |
| Q |
259 |
gtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|||||||||||||||||| ||| |||||| ||||||| |||||||||||| |||||||| |
|
|
| T |
19265891 |
gtgggaccccttcccgga-cctacatatgtgggagctttagtgcaccgggctgcccttt |
19265948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 96; E-Value: 8e-47
Query Start/End: Original strand, 185 - 317
Target Start/End: Original strand, 7879639 - 7879773
Alignment:
| Q |
185 |
aaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgc |
282 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7879639 |
aaggtcacgggttcaagtcctggaaacaatctcttgtgtaaaaaacaaggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgc |
7879738 |
T |
 |
| Q |
283 |
atatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
7879739 |
gtatgcgggagcttcagtgcaccgggttgcccttt |
7879773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 95; E-Value: 3e-46
Query Start/End: Original strand, 138 - 295
Target Start/End: Original strand, 13805057 - 13805214
Alignment:
| Q |
138 |
gaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaaca-gggtaag |
236 |
Q |
| |
|
|||||| | ||||||||| | |||||||||||||||||||||||| |||||| |||||||||||||||| ||| ||||||| |||||||||| ||||||| |
|
|
| T |
13805057 |
gagggggagccttggcgcaa-tggtaaagttgttgtcatgtgactgaaaggtaacgggttcaagtcctggaaatagcctctggtgtaaaacaggggtaag |
13805155 |
T |
 |
| Q |
237 |
gctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagct |
295 |
Q |
| |
|
|||| ||||||||||||||||||||||||| ||||| ||||||||| |||||||||||| |
|
|
| T |
13805156 |
gctgtgtacaatacaccaaatggtgggaccacttcctggaccctgcgtatgcgggagct |
13805214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 95; E-Value: 3e-46
Query Start/End: Original strand, 147 - 318
Target Start/End: Complemental strand, 23419845 - 23419673
Alignment:
| Q |
147 |
ccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgta |
244 |
Q |
| |
|
||||||||| || |||||||||| |||||||||||||||||||||| ||||||||| ||| |||||||||||||||||||| ||||||||| ||||||| |
|
|
| T |
23419845 |
ccttggcgcaac-ggtaaagttgctgtcatgtgactaaaaggtcacaggttcaagttctggaaacagcctcttgtgtaaaaaacagggtaagactgcgta |
23419747 |
T |
 |
| Q |
245 |
caatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttta |
318 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| ||| | |||||| ||| ||||||| |||| ||||||||| |
|
|
| T |
23419746 |
caatacaccaaatggtgggaccccttcctagaccttgcgtgtgcgggggctttagtgcatcgggctgcccttta |
23419673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 91; E-Value: 8e-44
Query Start/End: Original strand, 160 - 295
Target Start/End: Original strand, 19266426 - 19266563
Alignment:
| Q |
160 |
ggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaat |
257 |
Q |
| |
|
||||||||||||||||||||||| ||||||| |||||||||||||||||| |||| |||| |||||| |||||||||||||||||||||||||||||| |
|
|
| T |
19266426 |
ggtaaagttgttgtcatgtgactgaaaggtcgtgggttcaagtcctgaaaatagccacttgcgtaaaaaacagggtaaggctgcgtacaatacaccaaat |
19266525 |
T |
 |
| Q |
258 |
ggtgggaccccttcccggaccctgcatatgcgggagct |
295 |
Q |
| |
|
|||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
19266526 |
tgtgggatcccttcccggaccctgcgtatgcgggagct |
19266563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 89; E-Value: 1e-42
Query Start/End: Original strand, 184 - 315
Target Start/End: Complemental strand, 18512587 - 18512455
Alignment:
| Q |
184 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaac-agggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgc |
282 |
Q |
| |
|
||||||||||||||||||||||| ||||| | |||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
18512587 |
aaaggtcacgggttcaagtcctggaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttcccggaccctgc |
18512488 |
T |
 |
| Q |
283 |
atatgcgggagctctagtgcaccgggttgccct |
315 |
Q |
| |
|
|||||||||||| | |||||| |||||||||| |
|
|
| T |
18512487 |
gtatgcgggagctttggtgcactgggttgccct |
18512455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 89; E-Value: 1e-42
Query Start/End: Original strand, 160 - 316
Target Start/End: Original strand, 29907393 - 29907552
Alignment:
| Q |
160 |
ggtaaagttgttgt--catgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaaggctgcgtacaatacacc-a |
254 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||||||||||||||| |||||||||||||||| |||| || |||||||||||| ||||||||| | |
|
|
| T |
29907393 |
ggtaaagttgttgtatcatgtgactgaaaggtcacgggttcaagtcctagaaacagcctcttgtgtaaaaaatagtgtaaggctgcgttcaatacaccaa |
29907492 |
T |
 |
| Q |
255 |
aatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctt |
316 |
Q |
| |
|
|||||||||||||| |||||||||||| |||||||||||| |||||||||||||||||||| |
|
|
| T |
29907493 |
aatggtgggaccccatcccggaccctg--tatgcgggagctttagtgcaccgggttgccctt |
29907552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 85; E-Value: 3e-40
Query Start/End: Original strand, 147 - 308
Target Start/End: Complemental strand, 28362316 - 28362155
Alignment:
| Q |
147 |
ccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacag--ggtaaggctgcgta |
244 |
Q |
| |
|
||||||||| || |||||||||||||||||||| || ||||||||| |||||||||||| |||| ||||||||||||||| | |||||||||||||| |
|
|
| T |
28362316 |
ccttggcgcaac-ggtaaagttgttgtcatgtggctgaaaggtcacaggttcaagtcctagaaactgcctcttgtgtaaaaaacttggtaaggctgcgta |
28362218 |
T |
 |
| Q |
245 |
caatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccggg |
308 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| |||||||| ||||||| | |||||||||| |
|
|
| T |
28362217 |
caatacaccaaatggtgggaccccttcccagaccttgcatatgtgggagct-ttgtgcaccggg |
28362155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 84; E-Value: 1e-39
Query Start/End: Original strand, 170 - 316
Target Start/End: Original strand, 18747472 - 18747621
Alignment:
| Q |
170 |
ttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa---cagggtaaggctgcgtacaatacaccaaatggtgggacc |
266 |
Q |
| |
|
|||||| |||||| |||||||||||| ||||||| || ||||||||| |||||||||| ||||||||||||||||| |||||||||| |||||||||| |
|
|
| T |
18747472 |
ttgtcacgtgactgaaaggtcacgggatcaagtcttggaaacagccttttgtgtaaaaaagcagggtaaggctgcgtataatacaccaattggtgggacc |
18747571 |
T |
 |
| Q |
267 |
ccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctt |
316 |
Q |
| |
|
|||||| | ||||||| |||||||||||| |||||||||||| ||||||| |
|
|
| T |
18747572 |
ccttcctgaaccctgcgtatgcgggagctttagtgcaccgggctgccctt |
18747621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 82; E-Value: 2e-38
Query Start/End: Original strand, 142 - 317
Target Start/End: Complemental strand, 14732999 - 14732821
Alignment:
| Q |
142 |
ggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcct--cttgtgtaaaacagggtaaggct |
239 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||| ||| |||| |||||||||||||| ||||||||| | ||| |||||||||||||||| |
|
|
| T |
14732999 |
ggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaagtcatgggttcaagtcctggaaacagcctcccatgtaaaaaacagggtaaggct |
14732900 |
T |
 |
| Q |
240 |
gcgtacaatacacc--aaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|||| ||||||||| |||||||| || |||||||| |||||| |||||||||||| ||||||||||| ||| ||||| |
|
|
| T |
14732899 |
gcgt-caatacaccaaaaatggtgaaactccttcccgaaccctgtttatgcgggagctttagtgcaccggattgtccttt |
14732821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 82; E-Value: 2e-38
Query Start/End: Original strand, 147 - 293
Target Start/End: Complemental strand, 48123655 - 48123508
Alignment:
| Q |
147 |
ccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaa--aacagggtaaggctgcgta |
244 |
Q |
| |
|
||||||||| || |||||||||||| ||||||| || |||||||| |||||||||||||| |||||||||||||||||| |||||||||| |||| || |
|
|
| T |
48123655 |
ccttggcgcaac-ggtaaagttgttatcatgtgtctgaaaggtcatgggttcaagtcctggaaacagcctcttgtgtaaataacagggtaaaactgcata |
48123557 |
T |
 |
| Q |
245 |
caatacaccaaatggtgggaccccttcccggaccctgcatatgcgggag |
293 |
Q |
| |
|
|||||||||||||||||||||||||| | ||||| |||||||||||||| |
|
|
| T |
48123556 |
caatacaccaaatggtgggacccctttctggaccatgcatatgcgggag |
48123508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 81; E-Value: 7e-38
Query Start/End: Original strand, 136 - 295
Target Start/End: Complemental strand, 28078314 - 28078154
Alignment:
| Q |
136 |
ctgaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa-cagggta |
234 |
Q |
| |
|
||||||||||||| |||||| ||| || ||||||||||||||||||| ||||||||||||||||||||| |||||| ||| ||| |||| ||||||| |
|
|
| T |
28078314 |
ctgaggggtaaccctggcgcaactcgtgaagttgttgtcatgtgactgtaaggtcacgggttcaagtcctagaaacagtctcgtgtaaaaaaacagggta |
28078215 |
T |
 |
| Q |
235 |
aggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagct |
295 |
Q |
| |
|
||| ||| | |||||||||||||||||||||||||||||| | |||||||||||| ||||| |
|
|
| T |
28078214 |
aggttgcatgcaatacaccaaatggtgggaccccttcccgaatcctgcatatgcgagagct |
28078154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 80; E-Value: 3e-37
Query Start/End: Original strand, 139 - 273
Target Start/End: Complemental strand, 8149126 - 8148989
Alignment:
| Q |
139 |
aggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt---aaaacagggtaa |
235 |
Q |
| |
|
||||||||||||||| | |||||||| ||||||||||||||||| || |||||| ||||||||||||||||| |||||||||| |||| ||||||| |
|
|
| T |
8149126 |
aggggtaaccttggcacaactggtaatgttgttgtcatgtgactgcaaagtcacgagttcaagtcctgaaaactacctcttgtgttaaaaaatagggtaa |
8149027 |
T |
 |
| Q |
236 |
ggctgcgtacaatacaccaaatggtgggaccccttccc |
273 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
8149026 |
ggttgcgtacaatacaccaaatggtgggaccccttccc |
8148989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 77; E-Value: 2e-35
Query Start/End: Original strand, 160 - 293
Target Start/End: Complemental strand, 14099165 - 14099030
Alignment:
| Q |
160 |
ggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaat |
257 |
Q |
| |
|
||||||||||||||||||||||| |||||||| ||||| |||||||| ||| ||||| |||||||||| |||| |||| |||||||||||||||||||| |
|
|
| T |
14099165 |
ggtaaagttgttgtcatgtgactgaaaggtcatgggttgaagtcctggaaatagccttttgtgtaaaaaacaggttaagactgcgtacaatacaccaaat |
14099066 |
T |
 |
| Q |
258 |
ggtgggaccccttcccggaccctgcatatgcgggag |
293 |
Q |
| |
|
||||||||||||||||| ||||| | ||||| |||| |
|
|
| T |
14099065 |
ggtgggaccccttcccgaaccctacgtatgcaggag |
14099030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 77; E-Value: 2e-35
Query Start/End: Original strand, 160 - 293
Target Start/End: Complemental strand, 14409182 - 14409047
Alignment:
| Q |
160 |
ggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaat |
257 |
Q |
| |
|
||||||||||||||||||||||| |||||||| ||||| |||||||| ||| ||||| |||||||||| |||| |||| |||||||||||||||||||| |
|
|
| T |
14409182 |
ggtaaagttgttgtcatgtgactgaaaggtcatgggttgaagtcctggaaatagccttttgtgtaaaaaacaggttaagactgcgtacaatacaccaaat |
14409083 |
T |
 |
| Q |
258 |
ggtgggaccccttcccggaccctgcatatgcgggag |
293 |
Q |
| |
|
||||||||||||||||| ||||| | ||||| |||| |
|
|
| T |
14409082 |
ggtgggaccccttcccgaaccctacgtatgcaggag |
14409047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 76; E-Value: 7e-35
Query Start/End: Original strand, 167 - 317
Target Start/End: Complemental strand, 32233286 - 32233135
Alignment:
| Q |
167 |
ttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa-cagggtaaggctgcgtacaatacaccaaatggtgggac |
265 |
Q |
| |
|
||||||||| ||||| |||||||| |||||||||||||| ||||| |||||||||||||| ||||||||||| ||||| | ||||||||||||||||| |
|
|
| T |
32233286 |
ttgttgtcacctgactgaaaggtcatgggttcaagtcctggaaacaacctcttgtgtaaaaacagggtaaggcagcgtatattacaccaaatggtgggat |
32233187 |
T |
 |
| Q |
266 |
cccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
||||||| |||||||||||| ||||||| ||||||||||| |||||||| |
|
|
| T |
32233186 |
tccttcccaaaccctgcatatgagggagcttcagtgcaccgggctgcccttt |
32233135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 75; E-Value: 3e-34
Query Start/End: Original strand, 139 - 240
Target Start/End: Original strand, 18326989 - 18327091
Alignment:
| Q |
139 |
aggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt-aaaacagggtaagg |
237 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||| | |||||||||||||||| |||||||||||||| |
|
|
| T |
18326989 |
aggggtaaccttggcgcaactggtaaagttgttgtcatgtgacttgaaggtcacgggttcaagtcccggaaacagcctcttgtgtaaaaacagggtaagg |
18327088 |
T |
 |
| Q |
238 |
ctg |
240 |
Q |
| |
|
||| |
|
|
| T |
18327089 |
ctg |
18327091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 74; E-Value: 1e-33
Query Start/End: Original strand, 175 - 317
Target Start/End: Complemental strand, 38262340 - 38262196
Alignment:
| Q |
175 |
atgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacag--ggtaaggctgcgtacaatacaccaaatggtgggaccccttcc |
272 |
Q |
| |
|
|||||||| |||||||||||||||||||||| |||||| ||||||||||||| | ||||| | ||| |||||||||||||||| ||||||||||||| |
|
|
| T |
38262340 |
atgtgactggaaggtcacgggttcaagtcctggaaacagtctcttgtgtaaaaaatatggtaatgttgcatacaatacaccaaatgatgggaccccttcc |
38262241 |
T |
 |
| Q |
273 |
cggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|| || |||| |||||||||||| ||||||||||| ||||||||| |
|
|
| T |
38262240 |
cgaacactgcgtatgcgggagctttagtgcaccggattgcccttt |
38262196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 74; E-Value: 1e-33
Query Start/End: Original strand, 137 - 237
Target Start/End: Complemental strand, 42496017 - 42495916
Alignment:
| Q |
137 |
tgaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt-aaaacagggtaa |
235 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||| ||||||||||||||||||||||| |||||||||||||| | |||||||||||| |
|
|
| T |
42496017 |
tgaggggtaaccttggcgcaactggtaaagttgttgtcatatgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtataaaaacagggtaa |
42495918 |
T |
 |
| Q |
236 |
gg |
237 |
Q |
| |
|
|| |
|
|
| T |
42495917 |
gg |
42495916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 73; E-Value: 4e-33
Query Start/End: Original strand, 160 - 316
Target Start/End: Original strand, 16341254 - 16341413
Alignment:
| Q |
160 |
ggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaaggctgcgtacaatacacc-aaa |
256 |
Q |
| |
|
|||||||||||| |||||| | ||||||||||||||||||| || |||||||||||||||| |||||||||||||||| ||||||||||||| ||| |
|
|
| T |
16341254 |
ggtaaagttgttatcatgtatttgaaaggtcacgggttcaagttctagaaacagcctcttgtgtaaaaaacagggtaaggctacgtacaatacaccaaaa |
16341353 |
T |
 |
| Q |
257 |
tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctt |
316 |
Q |
| |
|
||||||| || ||||||||||| |||||||||||||| | |||||||||| ||||||| |
|
|
| T |
16341354 |
tggtgggccctcttcccggacctatcatatgcgggagctttggtgcaccgggctgccctt |
16341413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 73; E-Value: 4e-33
Query Start/End: Original strand, 203 - 309
Target Start/End: Original strand, 38604546 - 38604654
Alignment:
| Q |
203 |
cctgaaaacagcctcttgtgtaaaa-cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctct-agt |
300 |
Q |
| |
|
|||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||| ||||||||||| |||||||||||| | ||| |
|
|
| T |
38604546 |
cctggaaacagcctcttgtgtaaaaacagggtaaggctgcgtacaatacaccaaatggtgagacccctttccggaccctgcgtatgcgggagctttaagt |
38604645 |
T |
 |
| Q |
301 |
gcaccgggt |
309 |
Q |
| |
|
||||||||| |
|
|
| T |
38604646 |
gcaccgggt |
38604654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 71; E-Value: 7e-32
Query Start/End: Original strand, 137 - 256
Target Start/End: Original strand, 12473257 - 12473378
Alignment:
| Q |
137 |
tgaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggta |
234 |
Q |
| |
|
||||||||| ||||||||| || ||||||||||||||||||| || |||||||| |||||||||||||| ||||| |||||||||| ||||||||||| |
|
|
| T |
12473257 |
tgaggggtagccttggcgcaaccggtaaagttgttgtcatgtatctgaaaggtcatgggttcaagtcctgcaaacaacctcttgtgtcaaaaacagggta |
12473356 |
T |
 |
| Q |
235 |
aggctgcgtacaatacaccaaa |
256 |
Q |
| |
|
||| |||||||||||||||||| |
|
|
| T |
12473357 |
aggatgcgtacaatacaccaaa |
12473378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 70; E-Value: 3e-31
Query Start/End: Original strand, 209 - 317
Target Start/End: Complemental strand, 35787378 - 35787269
Alignment:
| Q |
209 |
aacagcctcttgtgtaaaa-cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgg |
307 |
Q |
| |
|
||||||||||||||||||| || ||||||| ||||||||||||||||||||| |||||||||||||||||| ||| |||||||||||| | |||||||| |
|
|
| T |
35787378 |
aacagcctcttgtgtaaaaacatggtaaggttgcgtacaatacaccaaatggcgggaccccttcccggaccttgcgtatgcgggagcttcaatgcaccgg |
35787279 |
T |
 |
| Q |
308 |
gttgcccttt |
317 |
Q |
| |
|
|||||||||| |
|
|
| T |
35787278 |
gttgcccttt |
35787269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #48
Raw Score: 70; E-Value: 3e-31
Query Start/End: Original strand, 159 - 305
Target Start/End: Original strand, 39123865 - 39124018
Alignment:
| Q |
159 |
tggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt-aaaacagggt----aaggctgcgtacaatacacc |
253 |
Q |
| |
|
|||||||||||||||||||||||| ||| | |||||||||||||||| |||| | ||||||||| |||||||||| ||||||||||| |||||||| |
|
|
| T |
39123865 |
tggtaaagttgttgtcatgtgactgaaacgacacgggttcaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacacc |
39123964 |
T |
 |
| Q |
254 |
--aaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcacc |
305 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| ||||||| | ||||||| |
|
|
| T |
39123965 |
aaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcacc |
39124018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #49
Raw Score: 69; E-Value: 1e-30
Query Start/End: Original strand, 139 - 256
Target Start/End: Complemental strand, 5180337 - 5180218
Alignment:
| Q |
139 |
aggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaag |
236 |
Q |
| |
|
||||||||||||| ||| |||||||||||||||||||||||||| |||||||| |||||||| | ||| |||||||||||||||| ||||||||||||| |
|
|
| T |
5180337 |
aggggtaaccttgacgcaactggtaaagttgttgtcatgtgactgaaaggtcaagggttcaacttctggaaacagcctcttgtgtcaaaaacagggtaag |
5180238 |
T |
 |
| Q |
237 |
gctgcgtacaatacaccaaa |
256 |
Q |
| |
|
||| |||||| |||||||| |
|
|
| T |
5180237 |
actgtgtacaacacaccaaa |
5180218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #50
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 234 - 317
Target Start/End: Complemental strand, 27889399 - 27889316
Alignment:
| Q |
234 |
aaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| | || |||||||||||||||| |
|
|
| T |
27889399 |
aaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttggtacaccgggttgcccttt |
27889316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #51
Raw Score: 66; E-Value: 6e-29
Query Start/End: Original strand, 159 - 292
Target Start/End: Original strand, 7644931 - 7645066
Alignment:
| Q |
159 |
tggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaaggctgcgtacaatacacc-aa |
255 |
Q |
| |
|
||||||| ||||||| | |||||| ||||||||||||||||||||||| |||||||||||||||| ||||||||||||| |||||||||||||| || |
|
|
| T |
7644931 |
tggtaaatttgttgtaacgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaagatagcgtacaatacaccaaa |
7645030 |
T |
 |
| Q |
256 |
atggtgggaccccttcccggaccctgcatatgcggga |
292 |
Q |
| |
|
|| |||||||||||| || |||||||| ||||||||| |
|
|
| T |
7645031 |
attgtgggacccctt-cctgaccctgcgtatgcggga |
7645066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #52
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 188 - 308
Target Start/End: Original strand, 21566439 - 21566562
Alignment:
| Q |
188 |
gtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaa-tggtgggaccccttcccggaccctgcat |
284 |
Q |
| |
|
||||| |||||||||| || |||| ||||||||||||||| ||| | ||| ||||||||||||||||||| |||| ||||||||||||| ||||||||| |
|
|
| T |
21566439 |
gtcacaggttcaagtcttggaaaccgcctcttgtgtaaaaaacagaggaagactgcgtacaatacaccaaaatggtaggaccccttcccgaaccctgcat |
21566538 |
T |
 |
| Q |
285 |
atgcgggagctctagtgcaccggg |
308 |
Q |
| |
|
||||||||||| |||||||||||| |
|
|
| T |
21566539 |
atgcgggagctttagtgcaccggg |
21566562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #53
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 147 - 316
Target Start/End: Complemental strand, 3469350 - 3469176
Alignment:
| Q |
147 |
ccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt----aaaacagggtaaggctgcg |
242 |
Q |
| |
|
||||||||| || ||||||||||||||||||||||| ||||||||| | ||||||||| ||||| ||||||||| ||||||||||| || |||| |
|
|
| T |
3469350 |
ccttggcgcaac-ggtaaagttgttgtcatgtgactgaaaggtcacagactcaagtcctagaaacattctcttgtgtaaaaaaaacagggtacggttgcg |
3469252 |
T |
 |
| Q |
243 |
tacaatacacc--aaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctt |
316 |
Q |
| |
|
||||||||||| |||||| |||||||||||| ||||||| |||||||||||| |||||| | ||||||||||| |
|
|
| T |
3469251 |
tacaatacaccaaaaatggcgggaccccttcctagaccctgtgtatgcgggagctttagtgcgctgggttgccctt |
3469176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #54
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 161 - 262
Target Start/End: Original strand, 6736867 - 6736969
Alignment:
| Q |
161 |
gtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt-aaaacagggtaaggctgcgtacaatacaccaaatgg |
259 |
Q |
| |
|
||||||||||||||||| |||| |||||||||||||||||||||| |||||| |||||||| | |||||| |||||| |||| ||||||||||||||||| |
|
|
| T |
6736867 |
gtaaagttgttgtcatgcgactgaaaggtcacgggttcaagtcctcaaaacaacctcttgtataaaaacaaggtaagactgcatacaatacaccaaatgg |
6736966 |
T |
 |
| Q |
260 |
tgg |
262 |
Q |
| |
|
||| |
|
|
| T |
6736967 |
tgg |
6736969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #55
Raw Score: 61; E-Value: 6e-26
Query Start/End: Original strand, 196 - 313
Target Start/End: Original strand, 1408469 - 1408588
Alignment:
| Q |
196 |
ttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggag |
293 |
Q |
| |
|
||||||||||| ||| |||||||||||||||| || |||||||||| |||||||||| |||||||||||||||||||||||||||||| ||||| | | |
|
|
| T |
1408469 |
ttcaagtcctggaaatagcctcttgtgtaaaaaacaaggtaaggctgtgtacaatacagcaaatggtgggaccccttcccggaccctgcgtatgcagaat |
1408568 |
T |
 |
| Q |
294 |
ctctagtgcaccgggttgcc |
313 |
Q |
| |
|
|| |||| |||||| ||||| |
|
|
| T |
1408569 |
ctttagttcaccggattgcc |
1408588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #56
Raw Score: 61; E-Value: 6e-26
Query Start/End: Original strand, 138 - 226
Target Start/End: Original strand, 7193039 - 7193127
Alignment:
| Q |
138 |
gaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaa |
226 |
Q |
| |
|
||||||||||||||||| ||| |||||||||||||||||||||| |||||||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
7193039 |
gaggggtaaccttggcgtaacttgtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctcgaaacaacctcttgtgtaaa |
7193127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #57
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 200 - 318
Target Start/End: Original strand, 23231573 - 23231693
Alignment:
| Q |
200 |
agtcctgaaaacagcctcttgtgtaaaacag--ggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctct |
297 |
Q |
| |
|
||||||| ||| |||||||||||||||| | |||||||||||||| |||||||| |||| ||||||||||||||| ||||||| ||||||| |||| | |
|
|
| T |
23231573 |
agtcctggaaagagcctcttgtgtaaaatataaggtaaggctgcgtataatacaccgaatgatgggaccccttcccgaaccctgcgtatgcggcagcttt |
23231672 |
T |
 |
| Q |
298 |
agtgcaccgggttgcccttta |
318 |
Q |
| |
|
||||||||| ||| ||||||| |
|
|
| T |
23231673 |
agtgcaccgagtttcccttta |
23231693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #58
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 143 - 227
Target Start/End: Complemental strand, 7794682 - 7794598
Alignment:
| Q |
143 |
gtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa |
227 |
Q |
| |
|
|||||||| |||| ||||||||||||||||| |||||||| |||||||||||||||||||||| |||||||||||| ||||||| |
|
|
| T |
7794682 |
gtaaccttagcgcaactggtaaagttgttgttatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttatgtaaaa |
7794598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #59
Raw Score: 54; E-Value: 9e-22
Query Start/End: Original strand, 138 - 227
Target Start/End: Original strand, 21447544 - 21447633
Alignment:
| Q |
138 |
gaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa |
227 |
Q |
| |
|
|||||||||||||||||| |||| |||| |||||||||||| | | |||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
21447544 |
gaggggtaaccttggcgcaactgataaatttgttgtcatgtaattggaaggtcacggattcaagtcttgaaaacagcctcttgtgtaaaa |
21447633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #60
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 160 - 295
Target Start/End: Complemental strand, 44123780 - 44123644
Alignment:
| Q |
160 |
ggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt-aaaacagggtaaggctgcgtacaatacaccaaatg |
258 |
Q |
| |
|
|||||||||| |||||||||||| |||| | |||||||||||| ||| |||||||||||||||| |||||| ||||||| ||| | ||||||||| || |
|
|
| T |
44123780 |
ggtaaagttggtgtcatgtgactgaaagattacgggttcaagtactggaaacagcctcttgtgtaaaaacaaggtaaggttgcatgaaatacaccatata |
44123681 |
T |
 |
| Q |
259 |
gtgggaccccttcccggaccctgcatatgcgggagct |
295 |
Q |
| |
|
|||||||| ||| ||||| |||| ||||| |||||| |
|
|
| T |
44123680 |
atgggacccgttctcggacactgcgtatgcaggagct |
44123644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #61
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 144 - 255
Target Start/End: Complemental strand, 1424085 - 1423972
Alignment:
| Q |
144 |
taaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaaggctgc |
241 |
Q |
| |
|
|||| ||||||| ||||||||||||||||| |||||||| |||||||||| ||||| ||||| |||||| || |||||| |||||||||||| ||||| |
|
|
| T |
1424085 |
taactttggcgcaactggtaaagttgttgttatgtgactggaaggtcacggattcaaatcctggaaacagtctgttgtgtaaaaaacagggtaatgctgc |
1423986 |
T |
 |
| Q |
242 |
gtacaatacaccaa |
255 |
Q |
| |
|
|||| |||||||| |
|
|
| T |
1423985 |
atacactacaccaa |
1423972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #62
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 141 - 317
Target Start/End: Original strand, 25198679 - 25198861
Alignment:
| Q |
141 |
gggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaa---gtcctgaaaacagcctcttgtgtaaaa---cagggta |
234 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| ||||| |||| ||| ||| |||| ||| || |||||| || |||||||||| || |||| |
|
|
| T |
25198679 |
gggtaaccttggcgtaactggtaaagttgttgtcatatgactgaaagatcatgggatcaaaaagtcttggaaacagtcttttgtgtaaaaaaacaaggta |
25198778 |
T |
 |
| Q |
235 |
aggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|| | ||||| ||| ||| ||||||| ||| |||||||| |||||| | |||| | ||||| |||||||||||||||| |||| |
|
|
| T |
25198779 |
agaccgcgtataatgcactaaatggtaggatcccttcccagacccttcgtatgtgagagctttagtgcaccgggttgcacttt |
25198861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #63
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 160 - 302
Target Start/End: Complemental strand, 42102044 - 42101899
Alignment:
| Q |
160 |
ggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctctt--gtgtaaaacagggtaaggctgcgtacaatacaccaaa- |
256 |
Q |
| |
|
|||||||||||||||| |||||| ||||||| |||||||||||| |||||||||||| || |||||||||||| ||||||||| ||| | ||| |
|
|
| T |
42102044 |
ggtaaagttgttgtcacgtgactggaaggtcaaaagttcaagtcctggaaacagcctcttccgtaaaaaacagggtaacactgcgtacagtactctaaag |
42101945 |
T |
 |
| Q |
257 |
tggtgggaccccttcccggaccctgcatatgcgggagctctagtgc |
302 |
Q |
| |
|
||||||||||| |||||||||||||| ||| ||| |||| |||||| |
|
|
| T |
42101944 |
tggtgggaccctttcccggaccctgcgtatccggcagctttagtgc |
42101899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #64
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 234 - 317
Target Start/End: Complemental strand, 45019010 - 45018923
Alignment:
| Q |
234 |
aaggctgcgtacaatacaccaaa----tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|||||||||||||||| |||||| |||||| ||||||||||||||||||| |||||||||||| ||||||||| ||||||||||| |
|
|
| T |
45019010 |
aaggctgcgtacaatataccaaaaaactggtggaaccccttcccggaccctgcgtatgcgggagctttagtgcaccaggttgcccttt |
45018923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #65
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 184 - 295
Target Start/End: Original strand, 35203439 - 35203554
Alignment:
| Q |
184 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaaggctgcgtacaatacacc--aaatggtgggaccccttcccggaccc |
279 |
Q |
| |
|
||||||||||||||||||||||| ||||| ||||||||| |||||||| |||| |||||||||||| ||| ||||||||||| ||||||| | || | |
|
|
| T |
35203439 |
aaaggtcacgggttcaagtcctggaaacattctcttgtgtaaaaaacaggataagactgcgtacaatataccaaaaatggtgggatcccttcctgaactc |
35203538 |
T |
 |
| Q |
280 |
tgcatatgcgggagct |
295 |
Q |
| |
|
| | |||||||||||| |
|
|
| T |
35203539 |
tacgtatgcgggagct |
35203554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #66
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 225 - 317
Target Start/End: Complemental strand, 39093532 - 39093439
Alignment:
| Q |
225 |
aaacagggtaaggctgcgtacaatacacca-aatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|||||||||||| ||| ||||||||||||| ||| |||||| ||||||||||| | ||||||||| | |||| |||||||||||| |||||||| |
|
|
| T |
39093532 |
aaacagggtaagactgtgtacaatacaccataatagtgggaacccttcccggaacttgcatatgcagaagctttagtgcaccgggctgcccttt |
39093439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #67
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 188 - 273
Target Start/End: Complemental strand, 15108527 - 15108441
Alignment:
| Q |
188 |
gtcacgggttcaagtcctgaaaacagcctcttgtgt-aaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttccc |
273 |
Q |
| |
|
|||||| |||||||||||| |||||| |||||||| |||||| |||||||||| |||||||||| ||||| |||||| |||||||| |
|
|
| T |
15108527 |
gtcacgagttcaagtcctggaaacagtttcttgtgtaaaaacaaggtaaggctgtgtacaatacatcaaatagtgggatcccttccc |
15108441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #68
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 223 - 317
Target Start/End: Complemental strand, 23619071 - 23618977
Alignment:
| Q |
223 |
taaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|||||||| ||||| || |||||||||| ||||||||||||||||||| | |||| ||| | ||| |||||| ||||||| ||||||||||||| |
|
|
| T |
23619071 |
taaaacagagtaagcttgtgtacaatacatcaaatggtgggaccccttcgcagaccttgcgtttgcaggagctttagtgcagcgggttgcccttt |
23618977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #69
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 225 - 292
Target Start/End: Original strand, 33500556 - 33500625
Alignment:
| Q |
225 |
aaacagggtaaggctgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcatatgcggga |
292 |
Q |
| |
|
|||||||||||| |||||||| |||||| ||| |||||||||||||||||||||||||| ||||||||| |
|
|
| T |
33500556 |
aaacagggtaagactgcgtactatacacaaaaaatggtgggaccccttcccggaccctgcgtatgcggga |
33500625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #70
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 159 - 315
Target Start/End: Original strand, 22065563 - 22065720
Alignment:
| Q |
159 |
tggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt-aaaacagggtaaggctgcgtacaatacaccaaat |
257 |
Q |
| |
|
||||||||||||||||| |||| | ||| |||| | |||||||| || ||||| |||||||||| |||| ||||||| ||||| ||||||| | ||||| |
|
|
| T |
22065563 |
tggtaaagttgttgtcacgtgattgaaaagtcatgagttcaagttttggaaacaacctcttgtgtaaaaatagggtaaagctgcatacaataaagcaaat |
22065662 |
T |
 |
| Q |
258 |
ggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccct |
315 |
Q |
| |
|
||| |||||||||||| || || ||||| |||| | ||||| |||||| |||||| |
|
|
| T |
22065663 |
agtgagaccccttcccgaactatgtgtatgcaggagttttagtgtaccgggctgccct |
22065720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #71
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 224 - 317
Target Start/End: Complemental strand, 23066018 - 23065925
Alignment:
| Q |
224 |
aaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|||||||| ||| | |||||||||||||||| ||| ||||| ||||| ||| | |||||||||| ||||||| | ||||||||| ||||||||| |
|
|
| T |
23066018 |
aaaacaggataaagttgcgtacaatacaccatatgatgggatccctttccgaatcctgcatatgtgggagctttggtgcaccggattgcccttt |
23065925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #72
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 235 - 307
Target Start/End: Complemental strand, 36267900 - 36267827
Alignment:
| Q |
235 |
aggctgcgtacaatacaccaaatggtgggaccc-cttcccggaccctgcatatgcgggagctctagtgcaccgg |
307 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
36267900 |
aggctgcgtacaatacaccaaatggttggacccatttcccgaaccctgtgtatgcgggagctttagtgcaccgg |
36267827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #73
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 215 - 304
Target Start/End: Complemental strand, 21139851 - 21139761
Alignment:
| Q |
215 |
ctcttgtgtaaaa-cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcac |
304 |
Q |
| |
|
||||||||||||| ||| |||||| || |||| ||||||||||||||||||||||||||| || ||| ||||||| |||| |||||||| |
|
|
| T |
21139851 |
ctcttgtgtaaaaacagagtaaggttggatacagtacaccaaatggtgggaccccttcccgaactctgtgtatgcggaagctttagtgcac |
21139761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #74
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 162 - 314
Target Start/End: Complemental strand, 11458421 - 11458267
Alignment:
| Q |
162 |
taaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaaggctgcgtacaatacacc-aaatg |
258 |
Q |
| |
|
||||||| |||||||||||||||||||||||| |||||||| || ||| ||||| | ||| |||||| |||||||| |||| || ||||| ||||| |
|
|
| T |
11458421 |
taaagttattgtcatgtgactaaaaggtcacgagttcaagt-ctagaaatagcctactatgttgaaaacaaagtaaggcttcgtaaaacacaccaaaatg |
11458323 |
T |
 |
| Q |
259 |
gtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccc |
314 |
Q |
| |
|
||||| || ||| | |||||||| ||||| ||||| |||||||||||| ||||| |
|
|
| T |
11458322 |
gtggggcctctttgcagaccctgcgtatgcaagagctttagtgcaccgggctgccc |
11458267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #75
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 231 - 317
Target Start/End: Complemental strand, 13792237 - 13792150
Alignment:
| Q |
231 |
ggtaaggctgcgtacaatacacc-aaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|||||| |||| ||||||||||| |||||| ||||||||||| || ||||||| ||||| |||||| | |||||||| | |||||||| |
|
|
| T |
13792237 |
ggtaagactgcatacaatacacccaaatggcgggaccccttctcgaaccctgcgtatgctggagcttttgtgcaccgagctgcccttt |
13792150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #76
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 141 - 192
Target Start/End: Complemental strand, 29140538 - 29140487
Alignment:
| Q |
141 |
gggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcac |
192 |
Q |
| |
|
|||||| |||||||| |||||||||||||||||||||| ||| ||||||||| |
|
|
| T |
29140538 |
gggtaatcttggcgcaactggtaaagttgttgtcatgtaactgaaaggtcac |
29140487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #77
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 270 - 317
Target Start/End: Original strand, 36602535 - 36602582
Alignment:
| Q |
270 |
tcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|||| |||||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
36602535 |
tcccagaccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
36602582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #78
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 224 - 301
Target Start/End: Complemental strand, 17048909 - 17048831
Alignment:
| Q |
224 |
aaaacagggtaaggctgcgtacaatacacc-aaatggtgggaccccttcccggaccctgcatatgcgggagctctagtg |
301 |
Q |
| |
|
|||||||||||||| | ||||||||||||| ||||||||| ||||||||||||| | ||| |||| |||||| ||||| |
|
|
| T |
17048909 |
aaaacagggtaaggttacgtacaatacaccaaaatggtggaaccccttcccggaacttgcttatgtaggagctttagtg |
17048831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #79
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 135 - 251
Target Start/End: Original strand, 43852002 - 43852111
Alignment:
| Q |
135 |
tctgaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacaggg |
232 |
Q |
| |
|
||||||||| | |||||| || || ||||||||||||||||||||| ||||||||||||||||||||||| | |||||| ||| ||||||||| |
|
|
| T |
43852002 |
tctgagggggagccttggtgcaac-ggtaaagttgttgtcatgtga-------gtcacgggttcaagtcctgaaaa-aacctcttctgtaaaaaacaggg |
43852092 |
T |
 |
| Q |
233 |
taaggctgcgtacaataca |
251 |
Q |
| |
|
||||||| |||||||||| |
|
|
| T |
43852093 |
taaggctatgtacaataca |
43852111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #80
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 266 - 314
Target Start/End: Complemental strand, 42495913 - 42495865
Alignment:
| Q |
266 |
cccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccc |
314 |
Q |
| |
|
||||||||||||||||| |||||||||||| ||||||||| ||||||| |
|
|
| T |
42495913 |
cccttcccggaccctgcgtatgcgggagctttagtgcaccccgttgccc |
42495865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #81
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 254 - 317
Target Start/End: Original strand, 45811919 - 45811981
Alignment:
| Q |
254 |
aaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
||||||||||| ||||| || |||||||| ||||| |||||| ||||||| ||||||||||||| |
|
|
| T |
45811919 |
aaatggtgggatccctttccagaccctgcttatgcaggagctttagtgca-cgggttgcccttt |
45811981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #82
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 259 - 320
Target Start/End: Original strand, 11888414 - 11888475
Alignment:
| Q |
259 |
gtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttaat |
320 |
Q |
| |
|
|||||||||||| | |||||||| ||||| |||||| ||||||| ||||||||||||||| |
|
|
| T |
11888414 |
gtgggacccctttctggaccctgtgtatgcaggagcttcagtgcactgggttgccctttaat |
11888475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #83
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 199 - 315
Target Start/End: Original strand, 27697452 - 27697572
Alignment:
| Q |
199 |
aagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacacc-aaatggt--gggacccctt-cccggaccctgcatatgcggga |
292 |
Q |
| |
|
|||||||| ||||| |||||||||||||| ||||| ||||||| || |||||||| ||||||| ||||||| || ||| |||||||| ||||||||| |
|
|
| T |
27697452 |
aagtcctggaaacaacctcttgtgtaaaaatcagggcaaggctgtgt--aatacaccaaaatggtgggggaccctttccccagaccctgcgtatgcggga |
27697549 |
T |
 |
| Q |
293 |
gctctagtgcaccgggttgccct |
315 |
Q |
| |
|
||| | ||||||||| |||||| |
|
|
| T |
27697550 |
gcttaaatgcaccgggatgccct |
27697572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #84
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 160 - 224
Target Start/End: Complemental strand, 1524345 - 1524281
Alignment:
| Q |
160 |
ggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgta |
224 |
Q |
| |
|
|||||||| ||||||| | |||| ||||||||| ||||||||| | ||||||||||||||||| |
|
|
| T |
1524345 |
ggtaaagtggttgtcacgagactgaaaggtcacaagttcaagtcttataaacagcctcttgtgta |
1524281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #85
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 135 - 227
Target Start/End: Original strand, 5814422 - 5814514
Alignment:
| Q |
135 |
tctgaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa |
227 |
Q |
| |
|
|||||| ||| |||||||||| | |||||||||||||| |||||| | || ||||||||||||||| || ||| | |||||| ||||||| |
|
|
| T |
5814422 |
tctgagaggttaccttggcgcaatcggtaaagttgttgttatgtgattggaaagtcacgggttcaagttttggaaagaacctcttatgtaaaa |
5814514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 164; Significance: 2e-87; HSPs: 59)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 164; E-Value: 2e-87
Query Start/End: Original strand, 138 - 317
Target Start/End: Original strand, 1346918 - 1347097
Alignment:
| Q |
138 |
gaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaagg |
237 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
1346918 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagccacttgtgtaaaacagggtaagg |
1347017 |
T |
 |
| Q |
238 |
ctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1347018 |
ctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
1347097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 164; E-Value: 2e-87
Query Start/End: Original strand, 138 - 317
Target Start/End: Complemental strand, 1354936 - 1354757
Alignment:
| Q |
138 |
gaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaagg |
237 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||| ||||||||| ||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
1354936 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcactggttcaagtcctggaaacagcctcttgtgtaaaacagggtaagg |
1354837 |
T |
 |
| Q |
238 |
ctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1354836 |
ctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
1354757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 130; E-Value: 4e-67
Query Start/End: Original strand, 135 - 317
Target Start/End: Complemental strand, 29356042 - 29355855
Alignment:
| Q |
135 |
tctgaggggtaaccttggcgccactggtaaag-ttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaa--aacagg |
231 |
Q |
| |
|
||||||||||||||||||| | ||||||||| |||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||| |||||| |
|
|
| T |
29356042 |
tctgaggggtaaccttggcacaactggtaaaaattgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaagaaacagg |
29355943 |
T |
 |
| Q |
232 |
gtaaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
29355942 |
gtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
29355855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 121; E-Value: 1e-61
Query Start/End: Original strand, 148 - 317
Target Start/End: Complemental strand, 12222088 - 12221914
Alignment:
| Q |
148 |
cttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaaggctgcgtac |
245 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| |||||||||||||||||||| || |||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
12222088 |
cttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcttggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtac |
12221989 |
T |
 |
| Q |
246 |
aatacacca--aatggtgggaccccttcccggaccctgcatatgcgggagc-tctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| ||||||||||| | ||||||||||||||||||||| |
|
|
| T |
12221988 |
aatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagcttttagtgcaccgggttgcccttt |
12221914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 109; E-Value: 1e-54
Query Start/End: Original strand, 137 - 317
Target Start/End: Original strand, 9161076 - 9161259
Alignment:
| Q |
137 |
tgaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt-aaaacagggtaa |
235 |
Q |
| |
|
||||||||||||||| ||| | ||||||||||||||||||||||| ||||||||| ||||||||||||| |||||||||||||||| ||||||| |||| |
|
|
| T |
9161076 |
tgaggggtaaccttgacgcaatcggtaaagttgttgtcatgtgactgaaaggtcacaggttcaagtcctggaaacagcctcttgtgtaaaaacagagtaa |
9161175 |
T |
 |
| Q |
236 |
ggctgcgtacaatacacca--aatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|||||||||||||||| || ||||||||||||||||| |||||||||| ||||||| |||| ||||||||| ||||||||||| |
|
|
| T |
9161176 |
ggctgcgtacaatacatcaataatggtgggaccccttctcggaccctgcgtatgcggaagctttagtgcaccaggttgcccttt |
9161259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 104; E-Value: 1e-51
Query Start/End: Original strand, 202 - 317
Target Start/End: Original strand, 26097178 - 26097293
Alignment:
| Q |
202 |
tcctgaaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtg |
301 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26097178 |
tcctggaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatgaagggaccccttcccggaccctgcatatgcgggagctctagtg |
26097277 |
T |
 |
| Q |
302 |
caccgggttgcccttt |
317 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
26097278 |
caccgggttgcccttt |
26097293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 101; E-Value: 8e-50
Query Start/End: Original strand, 143 - 317
Target Start/End: Complemental strand, 2166587 - 2166410
Alignment:
| Q |
143 |
gtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaa--acagggtaaggctg |
240 |
Q |
| |
|
||||||||| ||| ||| ||||||||||||| |||||||| ||||||||||||||||||||||| ||||| ||||||||||||| ||||| ||||| || |
|
|
| T |
2166587 |
gtaaccttg-cgcaactagtaaagttgttgttatgtgactgaaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaatacaggataaggttg |
2166489 |
T |
 |
| Q |
241 |
cgtacaatacacca--aatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||| |||| |||||||| ||||||||||||||||||||| |
|
|
| T |
2166488 |
cgtacaatacaccaataatggtgggaccccttcccggaccctatatattcgggagctttagtgcaccgggttgcccttt |
2166410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 101; E-Value: 8e-50
Query Start/End: Original strand, 143 - 317
Target Start/End: Complemental strand, 2178220 - 2178043
Alignment:
| Q |
143 |
gtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaa--acagggtaaggctg |
240 |
Q |
| |
|
||||||||| ||| ||| ||||||||||||| |||||||| ||||||||||||||||||||||| ||||| ||||||||||||| ||||| ||||| || |
|
|
| T |
2178220 |
gtaaccttg-cgcaactagtaaagttgttgttatgtgactgaaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaatacaggataaggttg |
2178122 |
T |
 |
| Q |
241 |
cgtacaatacacca--aatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||| |||| |||||||| ||||||||||||||||||||| |
|
|
| T |
2178121 |
cgtacaatacaccaataatggtgggaccccttcccggaccctatatattcgggagctttagtgcaccgggttgcccttt |
2178043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 100; E-Value: 3e-49
Query Start/End: Original strand, 202 - 317
Target Start/End: Original strand, 25557743 - 25557858
Alignment:
| Q |
202 |
tcctgaaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtg |
301 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25557743 |
tcctggaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatgaaggaaccccttcccggaccctgcatatgcgggagctctagtg |
25557842 |
T |
 |
| Q |
302 |
caccgggttgcccttt |
317 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
25557843 |
caccgggttgcccttt |
25557858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 98; E-Value: 5e-48
Query Start/End: Original strand, 140 - 310
Target Start/End: Complemental strand, 3815256 - 3815084
Alignment:
| Q |
140 |
ggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaagg |
237 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||| ||| ||||||||||||||||||| |||||| || |||||| |||| | |||| | |
|
|
| T |
3815256 |
ggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaagtcctggaaacagactattgtgtaaaaaatatggtacga |
3815157 |
T |
 |
| Q |
238 |
ctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggtt |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||| ||||| | ||||||| |||| |||||||||||||| |
|
|
| T |
3815156 |
ctgcgtacaatacaccaaatggtgggaccctttcccgaaccctacgtatgcggaagctttagtgcaccgggtt |
3815084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 95; E-Value: 3e-46
Query Start/End: Original strand, 162 - 317
Target Start/End: Original strand, 28007604 - 28007760
Alignment:
| Q |
162 |
taaagttgttgtcatgtgact--aaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatgg |
259 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||| ||| |||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
28007604 |
taaagttgttgtcatgtgacatgaaaaggtcacgggttcaagtcctggaaagagcctcttgtgtaaaacagggtcaggctgcgtacaatacaccaaatgc |
28007703 |
T |
 |
| Q |
260 |
tgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|||||||||||||| | ||| ||||||||| |||||||||||||||| || |||||| |
|
|
| T |
28007704 |
tgggaccccttccc-taacctccatatgcggaagctctagtgcaccggattacccttt |
28007760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 90; E-Value: 3e-43
Query Start/End: Original strand, 138 - 315
Target Start/End: Complemental strand, 15866218 - 15866041
Alignment:
| Q |
138 |
gaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctctt--gtgtaaaacagggtaa |
235 |
Q |
| |
|
|||||||||||||||| | |||||||||||||||| ||||||| | |||||||| |||||||| ||||| |||||||||||| || |||||||||||| |
|
|
| T |
15866218 |
gaggggtaaccttggcccaactggtaaagttgttggcatgtgattgaaaggtcatgggttcaattcctggaaacagcctcttaagtaaaaaacagggtaa |
15866119 |
T |
 |
| Q |
236 |
ggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccct |
315 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||| | ||||||| || |||||||| | |||||||| |
|
|
| T |
15866118 |
agctgcgt--aatacaccaaatggtgggaccccttcccggaccctgcgtttgcgggatctatagtgcactgagttgccct |
15866041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 83; E-Value: 5e-39
Query Start/End: Original strand, 138 - 317
Target Start/End: Original strand, 1941809 - 1941990
Alignment:
| Q |
138 |
gaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaa |
235 |
Q |
| |
|
||||||||||||||| || |||||||||||||||||||| ||||| |||||| ||| || ||||| || ||||| |||||||||||||| |||||||| |
|
|
| T |
1941809 |
gaggggtaaccttggtgcaactggtaaagttgttgtcatctgactggaaggtcgcggattgaagtcatgtaaacaacctcttgtgtaaaaaacagggtaa |
1941908 |
T |
 |
| Q |
236 |
ggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||| ||| | || |||||||||| | | |||||||| |||||||||| |
|
|
| T |
1941909 |
ggctgcgtacaatacaccgaatggtgggaccccatcctggatcttgtgtatgcgggagtttttgtgcaccgtgttgcccttt |
1941990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 81; E-Value: 7e-38
Query Start/End: Original strand, 137 - 250
Target Start/End: Original strand, 8409196 - 8409311
Alignment:
| Q |
137 |
tgaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggta |
234 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| |||||||| ||||||||||| ||||||||||| |||| ||||||||||| ||||||||||| |
|
|
| T |
8409196 |
tgaggggtaaccttggcgcaactggtaaagttgttgtaatgtgactgaaaggtcacggattcaagtcctggaaactgcctcttgtgtaaaaaacagggta |
8409295 |
T |
 |
| Q |
235 |
aggctgcgtacaatac |
250 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
8409296 |
aggctgcgtacaatac |
8409311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 79; E-Value: 1e-36
Query Start/End: Original strand, 139 - 282
Target Start/End: Complemental strand, 13905158 - 13905015
Alignment:
| Q |
139 |
aggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaag |
236 |
Q |
| |
|
||||| ||||||||||| || ||||||||||||||||||||||| |||||||||||| ||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
13905158 |
agggggaaccttggcgcaac-ggtaaagttgttgtcatgtgactgaaaggtcacgggctcaagtcctgaaaacgacctcttgtgtaaaaaacagggtaag |
13905060 |
T |
 |
| Q |
237 |
gctgcgtacaatacaccaaatggtgggaccccttcccggaccctgc |
282 |
Q |
| |
|
||||| |||||| ||||||||||| |||||| |||||| ||||||| |
|
|
| T |
13905059 |
gctgcatacaattcaccaaatggt-ggaccctttcccgaaccctgc |
13905015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 78; E-Value: 4e-36
Query Start/End: Original strand, 170 - 315
Target Start/End: Complemental strand, 23240971 - 23240826
Alignment:
| Q |
170 |
ttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggacccct |
269 |
Q |
| |
|
|||||| |||||| ||||||||| ||| ||||||||| ||||||||||||||||||||||||||||| ||||||||||| ||||| ||||||||||||| |
|
|
| T |
23240971 |
ttgtcacgtgactgaaaggtcacaggtgcaagtcctggaaacagcctcttgtgtaaaacagggtaagtttgcgtacaatataccaattggtgggacccct |
23240872 |
T |
 |
| Q |
270 |
tcccggaccctgcatatgcgggagctctagtgcaccgggttgccct |
315 |
Q |
| |
|
|| |||| ||| |||||||||||| |||||||| ||| |||||| |
|
|
| T |
23240871 |
tctaggacaatgcgtatgcgggagctttagtgcactgggctgccct |
23240826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 76; E-Value: 7e-35
Query Start/End: Original strand, 137 - 313
Target Start/End: Complemental strand, 14975262 - 14975094
Alignment:
| Q |
137 |
tgaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaag |
236 |
Q |
| |
|
|||||| |||||||||||| || ||||||||||||||||||||||| |||||||||| ||||||||||| |||||||||||||||||||| | ||| |
|
|
| T |
14975262 |
tgagggataaccttggcgcaaccggtaaagttgttgtcatgtgactggaaggtcacggattcaagtcctggaaacagcctcttgtgtaaaaaa---caag |
14975166 |
T |
 |
| Q |
237 |
gctgcgtacaatacacca--aatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcc |
313 |
Q |
| |
|
| |||||||||| |||||||||||||||||||| |||| ||||||||||||| | ||||||||||||||||| |
|
|
| T |
14975165 |
g-------caatacaccaataatggtgggaccccttcccgaaccccgcatatgcgggagttttagtgcaccgggttgcc |
14975094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 76; E-Value: 7e-35
Query Start/End: Original strand, 169 - 317
Target Start/End: Complemental strand, 18277343 - 18277193
Alignment:
| Q |
169 |
gttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggacc |
266 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| || || |||||||||||||||||||| |||||||||| || ||||| |||||||||||||||||| |
|
|
| T |
18277343 |
gttgtcctgtgactaaaaggtcacgggttcaaatcttggaaacagcctcttgtgtaaaaatcagggtaaggttgagtacagaacaccaaatggtgggacc |
18277244 |
T |
 |
| Q |
267 |
ccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|||||| ||| || | |||||||||||| || |||||||||||| ||||| |
|
|
| T |
18277243 |
ccttcctagactctacgtatgcgggagctttactgcaccgggttgtccttt |
18277193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 73; E-Value: 4e-33
Query Start/End: Original strand, 142 - 317
Target Start/End: Complemental strand, 23930303 - 23930127
Alignment:
| Q |
142 |
ggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttc-aagtcctgaaaacagcctcttgtgtaaaacagggtaaggctg |
240 |
Q |
| |
|
|||||||||||||| ||| ||||| |||||||||||| || |||||||||| |||| ||||| || |||||| ||| ||||||||| | | | || |
|
|
| T |
23930303 |
ggtaaccttggcgcaactcataaagatgttgtcatgtgtctcaaaggtcacgagttccaagtcatggaaacagtctcatgtgtaaaaaacaagatagttg |
23930204 |
T |
 |
| Q |
241 |
cgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|||||||||||||| |||||||||||||||| |||||||||| |||||||||||| |||||||||| |||||||||| |
|
|
| T |
23930203 |
cgtacaatacaccagatggtgggaccccttcacggaccctgcttatgcgggagctttagtgcaccgagttgcccttt |
23930127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 72; E-Value: 2e-32
Query Start/End: Original strand, 147 - 318
Target Start/End: Complemental strand, 7947543 - 7947370
Alignment:
| Q |
147 |
ccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgta |
244 |
Q |
| |
|
||||||||| || |||||||||| ||| |||||| ||||||||| ||||||| ||||| ||||| |||| ||||||||| ||||||||||||||||| |
|
|
| T |
7947543 |
ccttggcgcaac-ggtaaagttggtgttgcgtgactgaaaggtcaccggttcaactcctggaaacaacctcctgtgtaaaaaccagggtaaggctgcgta |
7947445 |
T |
 |
| Q |
245 |
caatacaccaaa-tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttta |
318 |
Q |
| |
|
|||||||||||| ||||||| |||||||||||||| ||| |||| ||||||| |||||||| || ||||||||| |
|
|
| T |
7947444 |
caatacaccaaaatggtgggcccccttcccggaccttgcgtatgtgggagctttagtgcacttggctgcccttta |
7947370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 71; E-Value: 7e-32
Query Start/End: Original strand, 160 - 318
Target Start/End: Original strand, 12889402 - 12889563
Alignment:
| Q |
160 |
ggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaaggctgcgtacaatacacc-aaa |
256 |
Q |
| |
|
|||||||||||||||| |||| | ||||||||| |||||||||| ||||||||||||||||||| ||||||||| |||||||| ||||||||||| ||| |
|
|
| T |
12889402 |
ggtaaagttgttgtcacgtgagtgaaaggtcacaggttcaagtcttgaaaacagcctcttgtgttaaaaacagggcaaggctgcatacaatacacctaaa |
12889501 |
T |
 |
| Q |
257 |
tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttta |
318 |
Q |
| |
|
| ||||||||||| ||||||||| | || ||||||| ||||||| |||| ||||||||| |
|
|
| T |
12889502 |
cgatgggacccctttccggaccctctgtgtgtgggagctttagtgcatcgggctgcccttta |
12889563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 148 - 317
Target Start/End: Original strand, 24097545 - 24097712
Alignment:
| Q |
148 |
cttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtac |
245 |
Q |
| |
|
|||||| | ||||||||| ||| |||||||| ||| |||||||||| ||| ||||||| || ||||||||||| ||||| |||||||||||||| ||| |
|
|
| T |
24097545 |
cttggcacaactggtaaaattgatgtcatgttactgaaaggtcacgagtttaagtcctcgaaccagcctcttgtataaaaaacagggtaaggctgcttac |
24097644 |
T |
 |
| Q |
246 |
aatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||| ||||||| |||| ||||| || ||||||||||| |
|
|
| T |
24097645 |
aa----ccaaatggtgggaccccttcccggaccctgcgtatgcggaagctttagtgtcccaggttgcccttt |
24097712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 66; E-Value: 6e-29
Query Start/End: Original strand, 138 - 285
Target Start/End: Original strand, 6024187 - 6024338
Alignment:
| Q |
138 |
gaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaa |
235 |
Q |
| |
|
||||||||| ||| ||| |||||||||||||||||||||||| | |||||||||| ||||| |||| |||||||||||||||| |||||| ||||| |
|
|
| T |
6024187 |
gaggggtaattttgacgcaactggtaaagttgttgtcatgtgattggaaggtcacggtttcaaatcctagaaacagcctcttgtgtaaaaaacatggtaa |
6024286 |
T |
 |
| Q |
236 |
ggctgcgtacaatacacca--aatggtgggaccccttcccggaccctgcata |
285 |
Q |
| |
|
| ||||||||||||||||| |||| ||||||| |||||||||||| ||||| |
|
|
| T |
6024287 |
gactgcgtacaatacaccaataatgatgggacctcttcccggaccccgcata |
6024338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 157 - 295
Target Start/End: Original strand, 14553485 - 14553626
Alignment:
| Q |
157 |
actggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaaggctgcgtacaatacacca |
254 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| ||||||||||||| ||| ||| |||||||| |||| |||||||||||| ||| ||||||||| |
|
|
| T |
14553485 |
actggtaaagttgttgtcatgtgact-aaaggtcacaggttcaagtcctggaaatagcttcttgtgtaaaaaatagggtaaggctgtgtataatacacca |
14553583 |
T |
 |
| Q |
255 |
aa--tggtgggaccccttcccggaccctgcatatgcgggagct |
295 |
Q |
| |
|
|| ||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
14553584 |
aaactggtgggaccccttcgtagaccctgtgtatgcgggagct |
14553626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 194 - 300
Target Start/End: Original strand, 32579436 - 32579543
Alignment:
| Q |
194 |
ggttcaagtcctgaaaacagcctcttgtgtaaaac-agggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcggga |
292 |
Q |
| |
|
||||||||||||| ||||||||||| || ||||| | |||||| ||||||||||||| |||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
32579436 |
ggttcaagtcctggaaacagcctctggtataaaaatacggtaagcctgcgtacaataccccaaatggtgggaccccttcccagaccctgcatatgcggga |
32579535 |
T |
 |
| Q |
293 |
gctctagt |
300 |
Q |
| |
|
||| |||| |
|
|
| T |
32579536 |
gctttagt |
32579543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 61; E-Value: 6e-26
Query Start/End: Original strand, 189 - 306
Target Start/End: Original strand, 33138838 - 33138957
Alignment:
| Q |
189 |
tcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatat |
286 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| ||||| ||| ||||||| |||||||||||||||||||||||||||| || |||||||||| ||| |
|
|
| T |
33138838 |
tcacgggttcaagtcctggaaacaacctcttgtataaaaaacagagtaaggccgcgtacaatacaccaaatggtgggacccttttccggaccctgtgtat |
33138937 |
T |
 |
| Q |
287 |
gcgggagctctagtgcaccg |
306 |
Q |
| |
|
|| | |||| |||||||||| |
|
|
| T |
33138938 |
gcagtagctttagtgcaccg |
33138957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 142 - 306
Target Start/End: Original strand, 20400625 - 20400791
Alignment:
| Q |
142 |
ggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaaggct |
239 |
Q |
| |
|
|||||||||||||| | ||||| |||||||||||||||||| ||||||||| ||||||||| || ||||| ||||||||| ||||||||||||| || |
|
|
| T |
20400625 |
ggtaaccttggcgcaattggtatagttgttgtcatgtgactgaaaggtcacaggttcaagttatggaaacaatctcttgtgtaaaaaacagggtaagact |
20400724 |
T |
 |
| Q |
240 |
gcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccg |
306 |
Q |
| |
|
||||||| ||||| |||| | ||||||| || ||| ||||| | ||||| | | || |||||||||| |
|
|
| T |
20400725 |
gcgtacagtacactaaatagcgggacccttttccgaaccctacgtatgcagaaactttagtgcaccg |
20400791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 239 - 317
Target Start/End: Original strand, 12892064 - 12892144
Alignment:
| Q |
239 |
tgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|||||| |||||||||| |||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
12892064 |
tgcgtataatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttgcccttt |
12892144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 245 - 317
Target Start/End: Original strand, 13267788 - 13267860
Alignment:
| Q |
245 |
caatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| |||||||||||| |||||||||||||||||||| |
|
|
| T |
13267788 |
caatacaccaaatggtgggaccccttcctggaccctgcgtatgcgggagcttcagtgcaccgggttgcccttt |
13267860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 137 - 293
Target Start/End: Original strand, 22967124 - 22967287
Alignment:
| Q |
137 |
tgaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt-aaaacagggtaa |
235 |
Q |
| |
|
|||||||||||||| |||| ||| ||||||| ||||||||||||| |||||||| ||||||||| || ||||| | |||||||| |||| ||| ||| |
|
|
| T |
22967124 |
tgaggggtaaccttcgcgcatctgataaagttattgtcatgtgactgtaaggtcactagttcaagtcatggaaacaacttcttgtgtaaaaataggataa |
22967223 |
T |
 |
| Q |
236 |
ggctgc------gtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggag |
293 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
22967224 |
ggctgcatacaaatacaatacaccaaatggtgggaccccttcttggaccctgcctatgcgggag |
22967287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 137 - 293
Target Start/End: Complemental strand, 23821269 - 23821106
Alignment:
| Q |
137 |
tgaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt-aaaacagggtaa |
235 |
Q |
| |
|
|||||||||||||| |||| ||| ||||||| ||||||||||||| |||||||| ||||||||| || ||||| | |||||||| |||| ||| ||| |
|
|
| T |
23821269 |
tgaggggtaaccttcgcgcatctgataaagttattgtcatgtgactgtaaggtcactagttcaagtcatggaaacaacttcttgtgtaaaaataggataa |
23821170 |
T |
 |
| Q |
236 |
ggctgc------gtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggag |
293 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
23821169 |
ggctgcatacaaatacaatacaccaaatggtgggaccccttcttggaccctgcctatgcgggag |
23821106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 161 - 317
Target Start/End: Complemental strand, 32728314 - 32728157
Alignment:
| Q |
161 |
gtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaaggctgcgtacaatacaccaaatg |
258 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| | ||||||| || ||||| |||||| ||| ||||||||||||| ||| |||||||| ||||||| |
|
|
| T |
32728314 |
gtaaagttgttgtcatgtgactgaaaggtcacagattcaagttttggaaacaacctcttatgtaaaaaacagggtaagactgtgtacaatataccaaata |
32728215 |
T |
 |
| Q |
259 |
gtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|| || ||| ||||| |||||| | ||||||||| || ||||||||| |||||||||| |
|
|
| T |
32728214 |
gt-ggtccctttcccagaccctacgtatgcgggaactttagtgcaccatgttgcccttt |
32728157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 54; E-Value: 9e-22
Query Start/End: Original strand, 184 - 315
Target Start/End: Complemental strand, 15865991 - 15865859
Alignment:
| Q |
184 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa---cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccct |
280 |
Q |
| |
|
|||||||| |||||||| ||||| |||||||||||| |||||| |||||||| |||||||| |||||||||||||||||||||||||| ||||||| |
|
|
| T |
15865991 |
aaaggtcatgggttcaattcctggaaacagcctcttacgtaaaaaaacagggtaaagctgcgta--atacaccaaatggtgggaccccttcctggaccct |
15865894 |
T |
 |
| Q |
281 |
gcatatgcgggagctctagtgcaccgggttgccct |
315 |
Q |
| |
|
|| | |||| || || |||||||| | |||||||| |
|
|
| T |
15865893 |
gcgtttgcgtgatctatagtgcactgagttgccct |
15865859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 240 - 320
Target Start/End: Complemental strand, 383837 - 383757
Alignment:
| Q |
240 |
gcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttaat |
320 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| | |||||||| |||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
383837 |
gcgtacaatacaccaaattgtgggaccccttctcagaccctgcgtatgcgggagcttcagtccaccgggttgccctttaat |
383757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #35
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 142 - 290
Target Start/End: Original strand, 24734591 - 24734752
Alignment:
| Q |
142 |
ggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt-----------aaaacag |
230 |
Q |
| |
|
|||||| ||||||| |||||||||||||||||||||||||| |||||||| |||||| |||| ||||| |||||||||| ||||||| |
|
|
| T |
24734591 |
ggtaacattggcgcaactggtaaagttgttgtcatgtgactgaaaggtcaaaagttcaaatccttgaaacaacctcttgtgtaaaaaaaaaaaaaaacag |
24734690 |
T |
 |
| Q |
231 |
ggtaaggctgcgtacaatacacc--aaatggtgggaccccttcccggaccctgcatatgcgg |
290 |
Q |
| |
|
||||||| ||||||||||||| | ||| ||||||||||||||||||| ||||| ||||||| |
|
|
| T |
24734691 |
ggtaaggttgcgtacaatacaacaaaaaaggtgggaccccttcccggatcctgcgtatgcgg |
24734752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #36
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 255 - 317
Target Start/End: Original strand, 6808468 - 6808530
Alignment:
| Q |
255 |
aatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
6808468 |
aatggtgggaccccttcccggaccctgtgtatgcgggagctttagtgcaccgggttgcccttt |
6808530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #37
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 238 - 317
Target Start/End: Original strand, 12885967 - 12886048
Alignment:
| Q |
238 |
ctgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
||||||||||||||| ||| ||||||||||||||||| |||||||| |||| ||||||| ||||||||||||||||||||| |
|
|
| T |
12885967 |
ctgcgtacaatacacaaaaaatggtgggaccccttcccagaccctgcgtatgtgggagctttagtgcaccgggttgcccttt |
12886048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #38
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 160 - 316
Target Start/End: Complemental strand, 2755583 - 2755422
Alignment:
| Q |
160 |
ggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaaggctgcgtacaatacacc--aa |
255 |
Q |
| |
|
||||||||||||||||||||||| ||||||| |||||||||| || ||||| |||||| | |||| ||| ||||||||||||||||||||| || |
|
|
| T |
2755583 |
ggtaaagttgttgtcatgtgactgaaaggtcgtaggttcaagtcttgcaaacatcctcttataccaaaaataggctaaggctgcgtacaatacaccaaaa |
2755484 |
T |
 |
| Q |
256 |
atggtgggaccccttcccggaccctgcatat--gcgggagctctagtgcaccgggttgccctt |
316 |
Q |
| |
|
||||||||| ||||||| | ||||||||| ||||||||| ||||||||| |||||||||| |
|
|
| T |
2755483 |
atggtgggagtccttcccaaatcctgcatatgcgcgggagctttagtgcacc-ggttgccctt |
2755422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #39
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 176 - 319
Target Start/End: Original strand, 17432332 - 17432485
Alignment:
| Q |
176 |
tgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaaca--------gggtaaggctgcgtacaatacaccaaa--tggtgggac |
265 |
Q |
| |
|
||||||| ||||||||| ||||||||||||| ||||| | |||||||||||| | ||||||||||| ||||||||||| ||| ||||| ||| |
|
|
| T |
17432332 |
tgtgactgaaaggtcacaggttcaagtcctggaaacaacatcttgtgtaaaaaacagggtaagggtaaggctgtgtacaatacactaaaaatggtgagac |
17432431 |
T |
 |
| Q |
266 |
cccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttaa |
319 |
Q |
| |
|
| |||||||| |||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
17432432 |
cttttcccggatcctgtgcatgcgggagctttagtgcaccgggttgccctttaa |
17432485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #40
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 150 - 317
Target Start/End: Complemental strand, 3116299 - 3116129
Alignment:
| Q |
150 |
tggcgccactggtaaagttgttgtcatgtga-------ctaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaaggctgcg |
242 |
Q |
| |
|
|||||| || ||||||||||||||||||||| || |||||||| ||||||||||| || ||||| |||||||| ||||| | | ||||| |
|
|
| T |
3116299 |
tggcgcaaccggtaaagttgttgtcatgtgagttgcgactgaaaggtcatgggttcaagtcatggaaacaacctcttgtataaaa------atgactgcg |
3116206 |
T |
 |
| Q |
243 |
tacaatacaccaaa--tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
||||||||||||| ||||||||||||||| |||||| ||| |||||||||||| |||| |||||| ||||||||| |
|
|
| T |
3116205 |
cacaatacaccaaaaatggtgggaccccttctcggaccttgcgtatgcgggagctttagtacaccggattgcccttt |
3116129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #41
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 141 - 227
Target Start/End: Original strand, 12063424 - 12063510
Alignment:
| Q |
141 |
gggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa |
227 |
Q |
| |
|
|||||||||||| || |||| |||||||||| ||||| |||| |||||||||||||||||||||| ||| |||||||||| ||||| |
|
|
| T |
12063424 |
gggtaaccttggtgcaactgataaagttgttatcatgagactgaaaggtcacgggttcaagtcctagaaatagcctcttgtataaaa |
12063510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #42
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 249 - 319
Target Start/End: Complemental strand, 10734974 - 10734903
Alignment:
| Q |
249 |
acaccaaa-tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttaa |
319 |
Q |
| |
|
|||||||| ||||||| |||||||||||||||||| |||||||||||| |||| ||||||| |||||||||| |
|
|
| T |
10734974 |
acaccaaagtggtgggcccccttcccggaccctgcgtatgcgggagctttagtccaccgggctgccctttaa |
10734903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #43
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 138 - 205
Target Start/End: Complemental strand, 33923009 - 33922942
Alignment:
| Q |
138 |
gaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcct |
205 |
Q |
| |
|
|||||||||||||||||| || ||||||||||||||||| ||||| ||| ||||| |||||||||||| |
|
|
| T |
33923009 |
gaggggtaaccttggcgcaaccggtaaagttgttgtcatttgactgaaaagtcacaggttcaagtcct |
33922942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #44
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 207 - 317
Target Start/End: Complemental strand, 9671197 - 9671084
Alignment:
| Q |
207 |
aaaacagcctcttgtgt--aaaacagggtaaggctgcgtacaataca-ccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgca |
303 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| ||| |||| | ||||||| ||||||||| ||| |||||||| || |||||||| || |||| |
|
|
| T |
9671197 |
aaaacagcctcttgtgtaaaaaacagggtaaggctgcctactttacatcaaaatggtaggacccctttccgaaccctgcaaatacgggagctttaatgca |
9671098 |
T |
 |
| Q |
304 |
ccgggttgcccttt |
317 |
Q |
| |
|
|||| |||||||| |
|
|
| T |
9671097 |
tcgggctgcccttt |
9671084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #45
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 157 - 254
Target Start/End: Complemental strand, 27855600 - 27855500
Alignment:
| Q |
157 |
actggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt---aaaacagggtaaggctgcgtacaatacacc |
253 |
Q |
| |
|
|||||||||||| ||||||||||||| ||| ||| || ||| |||||| ||||||||| || ||||| |||| |||||||||||||||| |||||||| |
|
|
| T |
27855600 |
actggtaaagtttttgtcatgtgactgaaatgtcgcgagtttaagtcccgaaaacagcttcctgtgtaaaaaaatagggtaaggctgcgtataatacacc |
27855501 |
T |
 |
| Q |
254 |
a |
254 |
Q |
| |
|
| |
|
|
| T |
27855500 |
a |
27855500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #46
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 166 - 244
Target Start/End: Complemental strand, 4136670 - 4136590
Alignment:
| Q |
166 |
gttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaa--acagggtaaggctgcgta |
244 |
Q |
| |
|
||||||| || |||||||||| |||||||||||||||||| |||||| | ||||||||||| ||||||||||| |||||| |
|
|
| T |
4136670 |
gttgttgccacgtgactaaaatgtcacgggttcaagtcctaaaaacaacatcttgtgtaaaatacagggtaaggttgcgta |
4136590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #47
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 211 - 308
Target Start/End: Original strand, 19340855 - 19340954
Alignment:
| Q |
211 |
cagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaa-tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgg |
307 |
Q |
| |
|
||||||||||||||||| |||||||||| ||| ||||||||||||| || ||||||||||||| |||||| || ||||||| |||| ||||||| ||| |
|
|
| T |
19340855 |
cagcctcttgtgtaaaaaacagggtaaggttgca-acaatacaccaaaatgatgggaccccttcctggacccggcgtatgcggaagctttagtgcaacgg |
19340953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #48
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 249 - 307
Target Start/End: Original strand, 11395827 - 11395886
Alignment:
| Q |
249 |
acaccaaa-tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgg |
307 |
Q |
| |
|
|||||||| |||||||||||||||||||| ||||| |||||||||||| |||| |||||| |
|
|
| T |
11395827 |
acaccaaagtggtgggaccccttcccggatcctgcgtatgcgggagctttagtccaccgg |
11395886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #49
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 148 - 231
Target Start/End: Complemental strand, 19649338 - 19649255
Alignment:
| Q |
148 |
cttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagg |
231 |
Q |
| |
|
|||||||| |||| ||||||||||||||||||||| |||| |||||| || || | ||||||| |||| ||| | ||||||||| |
|
|
| T |
19649338 |
cttggcgcaactgataaagttgttgtcatgtgactgaaagatcacggatttaaattctgaaaatagccccttatctaaaacagg |
19649255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #50
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 282 - 317
Target Start/End: Original strand, 25997749 - 25997784
Alignment:
| Q |
282 |
catatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
25997749 |
catatgcgggagctctagtgcaccgggttgcccttt |
25997784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #51
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 184 - 247
Target Start/End: Original strand, 17448324 - 17448389
Alignment:
| Q |
184 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaaggctgcgtacaa |
247 |
Q |
| |
|
||||||||||||||||||| |||||||| | | |||||| |||||||||||||||||||||||| |
|
|
| T |
17448324 |
aaaggtcacgggttcaagttttgaaaacaacattttgtgtaaaaaacagggtaaggctgcgtacaa |
17448389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #52
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 162 - 270
Target Start/End: Original strand, 32068074 - 32068182
Alignment:
| Q |
162 |
taaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaaggctgcgtacaatacacc-aaatg |
258 |
Q |
| |
|
|||||||||||||| ||||| ||||||||| ||||||||| || ||| |||||||||| |||||||| ||| |||| ||||||||||| ||||| |
|
|
| T |
32068074 |
taaagttgttgtcacgtgaccgaaaggtcacatgttcaagtcttggaaa---cctcttgtgtaaaaaacaggataatgctgtttacaatacaccaaaatg |
32068170 |
T |
 |
| Q |
259 |
gtgggacccctt |
270 |
Q |
| |
|
|||||||||||| |
|
|
| T |
32068171 |
gtgggacccctt |
32068182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #53
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 194 - 287
Target Start/End: Original strand, 11849063 - 11849159
Alignment:
| Q |
194 |
ggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaaggctgcgtacaatacaccaaa-tggtgggaccccttcccggaccctgcatatg |
287 |
Q |
| |
|
||||||||||| | ||||| |||||||||| |||||||| ||| | ||| ||||||||||||| |||||||||||||||||| || |||| |||| |
|
|
| T |
11849063 |
ggttcaagtccaggaaacaacctcttgtgttaaaaacaggataaagttgcccacaatacaccaaaatggtgggaccccttcccgaactctgcgtatg |
11849159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #54
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 264 - 313
Target Start/End: Complemental strand, 30786427 - 30786378
Alignment:
| Q |
264 |
accccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcc |
313 |
Q |
| |
|
||||||||| ||||| ||| |||||||||||| ||||||||||||||||| |
|
|
| T |
30786427 |
accccttcctggaccgtgcgtatgcgggagctttagtgcaccgggttgcc |
30786378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #55
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 157 - 213
Target Start/End: Original strand, 8417445 - 8417501
Alignment:
| Q |
157 |
actggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacag |
213 |
Q |
| |
|
|||||||||||||||||||||||||| ||| |||||| ||||| ||| || |||||| |
|
|
| T |
8417445 |
actggtaaagttgttgtcatgtgactgaaatgtcacgagttcaggtcatggaaacag |
8417501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #56
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 258 - 317
Target Start/End: Complemental strand, 33922916 - 33922857
Alignment:
| Q |
258 |
ggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
||||| ||||||||||||||||||| |||| |||||| |||||||| ||||||||||| |
|
|
| T |
33922916 |
ggtggcaccccttcccggaccctgcttatgttggagctttagtgcacatggttgcccttt |
33922857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #57
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 27 - 61
Target Start/End: Original strand, 913229 - 913263
Alignment:
| Q |
27 |
gttgttatatactctcatcaatgcctttcttcttg |
61 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| |
|
|
| T |
913229 |
gttgttatatactatcatcaatgcctttcttcttg |
913263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #58
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 254 - 318
Target Start/End: Complemental strand, 16895761 - 16895695
Alignment:
| Q |
254 |
aaatggtgggacccc-ttcccggaccctgcatatgcgggagctctagtgcaccggg-ttgcccttta |
318 |
Q |
| |
|
||||||||||||||| |||||||||||| |||||| || || | |||||||||||| |||||||||| |
|
|
| T |
16895761 |
aaatggtgggacccccttcccggaccctacatatgtggaagttttagtgcaccgggtttgcccttta |
16895695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #59
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 224 - 253
Target Start/End: Complemental strand, 14341163 - 14341134
Alignment:
| Q |
224 |
aaaacagggtaaggctgcgtacaatacacc |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
14341163 |
aaaacagggtaaggctgcgtacaatacacc |
14341134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 161; Significance: 1e-85; HSPs: 102)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 161; E-Value: 1e-85
Query Start/End: Original strand, 137 - 317
Target Start/End: Original strand, 20224937 - 20225117
Alignment:
| Q |
137 |
tgaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaag |
236 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||| |||||||| |||||||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
20224937 |
tgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcatgggttcaagtcctggaaacaacctcttgtgtaaaacagggtaag |
20225036 |
T |
 |
| Q |
237 |
gctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20225037 |
gctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
20225117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 161; E-Value: 1e-85
Query Start/End: Original strand, 137 - 317
Target Start/End: Complemental strand, 48599005 - 48598825
Alignment:
| Q |
137 |
tgaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaag |
236 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
48599005 |
tgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaacagggtaag |
48598906 |
T |
 |
| Q |
237 |
gctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
48598905 |
gctgcgtacaatacaccaaatggtgggaccccttcccggaccatgcatatgccggagctctagtgcaccgggttgcccttt |
48598825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 152; E-Value: 3e-80
Query Start/End: Original strand, 138 - 317
Target Start/End: Complemental strand, 11054327 - 11054148
Alignment:
| Q |
138 |
gaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaagg |
237 |
Q |
| |
|
|||||||||| ||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
11054327 |
gaggggtaactttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctgaaaacagtctcttgtgtaaaacagggtaaga |
11054228 |
T |
 |
| Q |
238 |
ctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11054227 |
ctgcgtacaatacaccaaatggcggaaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
11054148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 152; E-Value: 3e-80
Query Start/End: Original strand, 138 - 317
Target Start/End: Complemental strand, 47528709 - 47528530
Alignment:
| Q |
138 |
gaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaagg |
237 |
Q |
| |
|
||||||||||||||| || |||||||||||||||||||||||||| ||||||||| ||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
47528709 |
gaggggtaaccttggtgcaactggtaaagttgttgtcatgtgactgaaaggtcacaggttcaagtcctggaaacagcctcttgtgtaaaacagggtaagg |
47528610 |
T |
 |
| Q |
238 |
ctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||| |
|
|
| T |
47528609 |
ctgcgtacaatacaccaaatggtgggaccccttcccggaccctgaatatgtgggagctctagtgcaccgggttgcccttt |
47528530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 142; E-Value: 3e-74
Query Start/End: Original strand, 137 - 317
Target Start/End: Original strand, 5648212 - 5648393
Alignment:
| Q |
137 |
tgaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa-cagggtaa |
235 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
5648212 |
tgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaacagggtaa |
5648311 |
T |
 |
| Q |
236 |
ggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||| |||||||||||| |
|
|
| T |
5648312 |
ggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagcttcagtgcactgggttgcccttt |
5648393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 141; E-Value: 1e-73
Query Start/End: Original strand, 137 - 316
Target Start/End: Complemental strand, 6430807 - 6430627
Alignment:
| Q |
137 |
tgaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa-cagggtaa |
235 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||| || |||||||||||||||||||| |||||||| |
|
|
| T |
6430807 |
tgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcatggaaacagcctcttgtgtaaaaacagggtaa |
6430708 |
T |
 |
| Q |
236 |
ggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctt |
316 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||| ||| |||||||||||||||| |
|
|
| T |
6430707 |
ggctgcgtacaatacaccaaatggtgggaccacttcccggaccctgcgtatgcgggagctttagcgcaccgggttgccctt |
6430627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 140; E-Value: 4e-73
Query Start/End: Original strand, 135 - 317
Target Start/End: Original strand, 30639331 - 30639514
Alignment:
| Q |
135 |
tctgaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa-cagggt |
233 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||| ||||||| ||||||||| ||||||||||||| |||||| ||||||||||||| |||||| |
|
|
| T |
30639331 |
tctgaggggtaaccttggcgcaactggtaaagttgttgtcttgtgactgaaaggtcactggttcaagtcctggaaacagactcttgtgtaaaaacagggt |
30639430 |
T |
 |
| Q |
234 |
aaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
30639431 |
aaggctgcgtacaatacaccaaatggtgagaccccttcccggaccctgcatatgcgggagctttagtgcactgggttgcccttt |
30639514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 132; E-Value: 3e-68
Query Start/End: Original strand, 162 - 317
Target Start/End: Complemental strand, 9832468 - 9832313
Alignment:
| Q |
162 |
taaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtg |
261 |
Q |
| |
|
|||| ||||||| || ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9832468 |
taaaattgttgtgatctgactgaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtg |
9832369 |
T |
 |
| Q |
262 |
ggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
||||||||||||||||||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
9832368 |
ggaccccttcccggaccctgcatatgcaggaactctagtgcaccgggttgcccttt |
9832313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 129; E-Value: 2e-66
Query Start/End: Original strand, 137 - 317
Target Start/End: Complemental strand, 5306845 - 5306660
Alignment:
| Q |
137 |
tgaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa-cagggtaa |
235 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |||||||||||| ||||||||||||||||||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
5306845 |
tgaggggtaaccttggcgcaactggtaaagttgatgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaatcagggtaa |
5306746 |
T |
 |
| Q |
236 |
ggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatg----cgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||| |||| |||||||| || |||||||||||||||||| |
|
|
| T |
5306745 |
ggttgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgtggacgggagctttaatgcaccgggttgcccttt |
5306660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 124; E-Value: 2e-63
Query Start/End: Original strand, 176 - 315
Target Start/End: Complemental strand, 29208039 - 29207900
Alignment:
| Q |
176 |
tgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccgg |
275 |
Q |
| |
|
||||||| ||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29208039 |
tgtgactgaaaggtcacgggttcaagtcctggaaattgcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccgg |
29207940 |
T |
 |
| Q |
276 |
accctgcatatgcgggagctctagtgcaccgggttgccct |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29207939 |
accctgcatatgcgggagctctagtgcaccgggttgccct |
29207900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 123; E-Value: 6e-63
Query Start/End: Original strand, 145 - 317
Target Start/End: Complemental strand, 16408777 - 16408601
Alignment:
| Q |
145 |
aaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaaggctgcg |
242 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
16408777 |
aaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaagactgcg |
16408678 |
T |
 |
| Q |
243 |
tacaatacacca--aatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
16408677 |
tacaatacaccaataatggtggaaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttgcccttt |
16408601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 123; E-Value: 6e-63
Query Start/End: Original strand, 138 - 317
Target Start/End: Original strand, 23501747 - 23501924
Alignment:
| Q |
138 |
gaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaa |
235 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
23501747 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtc------acagcctcttgtgtaaaaaacagggtaa |
23501840 |
T |
 |
| Q |
236 |
ggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
23501841 |
ggttgcgtacaatacaccaataatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcccttt |
23501924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 121; E-Value: 1e-61
Query Start/End: Original strand, 157 - 316
Target Start/End: Original strand, 40915802 - 40915962
Alignment:
| Q |
157 |
actggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa-cagggtaaggctgcgtacaatacaccaa |
255 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||| || ||||||||||||||||||||||||| |
|
|
| T |
40915802 |
actggtaaagttgttgtcatgtgactataaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaacaaggtaaggctgcgtacaatacaccaa |
40915901 |
T |
 |
| Q |
256 |
atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctt |
316 |
Q |
| |
|
||||||||| ||||||||||||||||| |||||||||||| |||||||||| |||||||| |
|
|
| T |
40915902 |
atggtgggagcccttcccggaccctgcgtatgcgggagcttcagtgcaccggattgccctt |
40915962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 119; E-Value: 1e-60
Query Start/End: Original strand, 141 - 317
Target Start/End: Original strand, 16911519 - 16911699
Alignment:
| Q |
141 |
gggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaaggc |
238 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||| ||| ||||||||||| |
|
|
| T |
16911519 |
gggtaaccttggcgcaactggtaaagttgttgtcatgtgacttaaaggtcacgggttcaagtcctagaaacagcctcttgtgtacaaatcagggtaaggc |
16911618 |
T |
 |
| Q |
239 |
tgcgtacaatacacca--aatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||| || ||||||||| |||| ||||||||||||||| |
|
|
| T |
16911619 |
tgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtacgcgggagctttagtttaccgggttgcccttt |
16911699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 115; E-Value: 4e-58
Query Start/End: Original strand, 138 - 314
Target Start/End: Original strand, 21646918 - 21647098
Alignment:
| Q |
138 |
gaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaa |
235 |
Q |
| |
|
||||| |||||||||||| |||||||||||||||||||||||||| |||||||| ||||||||||||| |||||||||||||||| |||| ||||||| |
|
|
| T |
21646918 |
gagggataaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacaggttcaagtcctggaaacagcctcttgtgtaaaaaatagggtaa |
21647017 |
T |
 |
| Q |
236 |
ggctgcgtacaatacacca--aatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccc |
314 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||| ||||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
21647018 |
ggctgcgtacaatataccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccc |
21647098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 113; E-Value: 6e-57
Query Start/End: Original strand, 165 - 313
Target Start/End: Complemental strand, 39077948 - 39077800
Alignment:
| Q |
165 |
agttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtggga |
264 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||| ||||||||||| || |
|
|
| T |
39077948 |
agttgttgtcatgtgattgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaacagggtaaggttgcgtacaatataccaaatggtgaga |
39077849 |
T |
 |
| Q |
265 |
ccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcc |
313 |
Q |
| |
|
| ||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39077848 |
catctttccggaccctgcatatgcgggagctctagtgcaccgggttgcc |
39077800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 112; E-Value: 2e-56
Query Start/End: Original strand, 157 - 318
Target Start/End: Complemental strand, 44363294 - 44363129
Alignment:
| Q |
157 |
actggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaaggctgcgtacaatacacc- |
253 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||| ||||| ||||||||||| |||||||||||| |||| |
|
|
| T |
44363294 |
actggtaaagttgttgtcatgtgactgaaaggtcacgagttcaagtcctgaaaacagcctcgtgtgtaaaaaacagggtagggctgcgtacaacgcacca |
44363195 |
T |
 |
| Q |
254 |
-aaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttta |
318 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
44363194 |
aaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttta |
44363129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 106; E-Value: 9e-53
Query Start/End: Original strand, 149 - 316
Target Start/End: Complemental strand, 8473790 - 8473621
Alignment:
| Q |
149 |
ttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaaggctgcgtacaat |
248 |
Q |
| |
|
||||||| |||||||||||||||||||| |||| ||||| ||||||||||||||| |||||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
8473790 |
ttggcgcaactggtaaagttgttgtcatatgaccggaaggttgcgggttcaagtcctggaaacagcctcttgtgtttaacagggtaaggctgcatacaat |
8473691 |
T |
 |
| Q |
249 |
acaccaaatggtgggacccctt-cccgga-ccctgcatatgcgggagctctagtgcaccgggttgccctt |
316 |
Q |
| |
|
|||||||||||||||||||||| |||||| ||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
8473690 |
acaccaaatggtgggaccccttccccggacccctgcatatgcgggagctttagtgcaccgggttgccctt |
8473621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 106; E-Value: 9e-53
Query Start/End: Original strand, 164 - 317
Target Start/End: Original strand, 54175043 - 54175200
Alignment:
| Q |
164 |
aagttgttgtcatgtgactaaaaggtcacgggttcaagtcctg-aaaacagcctcttgtgtaaaa-cagggtaaggctgcgtacaatacaccaaa-tggt |
260 |
Q |
| |
|
||||||||||||||||||| ||| ||||||| ||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||| |||| |
|
|
| T |
54175043 |
aagttgttgtcatgtgactgaaatgtcacggattcaagtcctggaaaacagcctcttgtgtaaaaacagggtaaggctgcgtacaatacaccaaaatggt |
54175142 |
T |
 |
| Q |
261 |
gggaccccttccc-ggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
54175143 |
gggaccccttccccggaccctgcatatgcgggagctttagtgcaccgggctgcccttt |
54175200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 101; E-Value: 8e-50
Query Start/End: Original strand, 184 - 317
Target Start/End: Original strand, 47443957 - 47444092
Alignment:
| Q |
184 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctg |
281 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47443957 |
aaaggtcacgggttcaagtcctggaaacagcctcttgcgtaaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctg |
47444056 |
T |
 |
| Q |
282 |
catatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
||||||| |||||| ||||||| |||||||||||| |
|
|
| T |
47444057 |
catatgcaggagcttcagtgcactgggttgcccttt |
47444092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 99; E-Value: 1e-48
Query Start/End: Original strand, 164 - 295
Target Start/End: Complemental strand, 17043549 - 17043416
Alignment:
| Q |
164 |
aagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtg |
261 |
Q |
| |
|
|||||||||||| |||||| ||||||||| ||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
17043549 |
aagttgttgtcaagtgactgaaaggtcacaggttcaagtcctggaaacagcctcttgtgtaaaatacagggtaaggctgcgtacaatacaccaaatggtg |
17043450 |
T |
 |
| Q |
262 |
ggaccccttcccggaccctgcatatgcgggagct |
295 |
Q |
| |
|
|||||||||||| |||||||||||||| |||||| |
|
|
| T |
17043449 |
ggaccccttcccagaccctgcatatgctggagct |
17043416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 97; E-Value: 2e-47
Query Start/End: Original strand, 138 - 317
Target Start/End: Complemental strand, 13256578 - 13256399
Alignment:
| Q |
138 |
gaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaa |
235 |
Q |
| |
|
||||||||||||||| || |||||||||||||||||||||||||| ||||||| ||||||||||||| |||||||||||| |||||||||||| |
|
|
| T |
13256578 |
gaggggtaaccttggtgcaactggtaaagttgttgtcatgtgactggaaggtcataggttcaagtcctg----gagcctcttgtgtaaaaaacagggtaa |
13256483 |
T |
 |
| Q |
236 |
ggctgcgtacaatacacca--aatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||||||||| |||| |||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
13256482 |
ggctgcgtacaatacaccaataatagtgggaccccttcccgaaccccgcatctgcgggagctttagtgcaccgggttgcccttt |
13256399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 97; E-Value: 2e-47
Query Start/End: Original strand, 160 - 317
Target Start/End: Original strand, 35567146 - 35567305
Alignment:
| Q |
160 |
ggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaat |
257 |
Q |
| |
|
||||||||||||||||||| ||| |||||||| ||||||||||| || |||||||| ||||||||||| ||||||||||||| |||||| ||||||||| |
|
|
| T |
35567146 |
ggtaaagttgttgtcatgtaactgaaaggtcatgggttcaagtcttggaaacagccacttgtgtaaaaaacagggtaaggctgtgtacaacacaccaaat |
35567245 |
T |
 |
| Q |
258 |
ggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
||||||||||||||||| ||||||| | |||||||||| |||||||||||| |||||||| |
|
|
| T |
35567246 |
ggtgggaccccttcccgaaccctgcgtctgcgggagctttagtgcaccgggctgcccttt |
35567305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 93; E-Value: 5e-45
Query Start/End: Original strand, 138 - 303
Target Start/End: Original strand, 37494805 - 37494972
Alignment:
| Q |
138 |
gaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaa |
235 |
Q |
| |
|
||||||||||||||| || |||||||||||||||| |||| |||| ||||||||| ||||||||||||| ||||| |||||||||| |||||||||||| |
|
|
| T |
37494805 |
gaggggtaaccttggtgcaactggtaaagttgttgccatgcgactgaaaggtcacaggttcaagtcctggaaacaacctcttgtgtaaaaaacagggtaa |
37494904 |
T |
 |
| Q |
236 |
ggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgca |
303 |
Q |
| |
|
|| ||| ||||||| |||||||||||||||||||| | ||||||||| ||||| |||||| ||||||| |
|
|
| T |
37494905 |
ggttgcatacaatataccaaatggtgggacccctttcgggaccctgcgtatgcaggagctttagtgca |
37494972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 90; E-Value: 3e-43
Query Start/End: Original strand, 143 - 317
Target Start/End: Complemental strand, 30352767 - 30352580
Alignment:
| Q |
143 |
gtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa-------cagggtaa |
235 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| ||||| |||||||||||||| ||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
30352767 |
gtaaccttggcgcaactggtaaagttgttgtcaagtgaccgaaaggtcacgggttagagtcctggaaacagcctcttgtgtaaaaaaaaaaacagggtaa |
30352668 |
T |
 |
| Q |
236 |
g----gctgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
| |||||||||||||||||||| ||||||||||||||| |||||||||| |||||||||||| |||||||||| |||||||||| |
|
|
| T |
30352667 |
gtaaagctgcgtacaatacaccaaaaatggtgggaccccttctcggaccctgcgtatgcgggagctttagtgcaccgtgttgcccttt |
30352580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 90; E-Value: 3e-43
Query Start/End: Original strand, 162 - 318
Target Start/End: Complemental strand, 30690340 - 30690175
Alignment:
| Q |
162 |
taaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa---------cagggtaaggctgcgtacaatacac |
252 |
Q |
| |
|
|||||| ||||||| |||||| ||||||||||||||||||||||| ||| |||||||||||||||| |||||||||||||| |||||||||| |
|
|
| T |
30690340 |
taaagtggttgtcaagtgactgaaaggtcacgggttcaagtcctggaaaaagcctcttgtgtaaaaaataaaaaacagggtaaggctgcatacaatacac |
30690241 |
T |
 |
| Q |
253 |
caaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttta |
318 |
Q |
| |
|
||| |||||||||||||||||||||||||| |||||||||||| ||||||||| || ||||||||| |
|
|
| T |
30690240 |
caattggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccaggctgcccttta |
30690175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 90; E-Value: 3e-43
Query Start/End: Original strand, 141 - 306
Target Start/End: Original strand, 54730206 - 54730376
Alignment:
| Q |
141 |
gggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt---aaaacagggtaagg |
237 |
Q |
| |
|
||||||| ||||||| | |||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||| |||| ||| ||||| |
|
|
| T |
54730206 |
gggtaactttggcgcaatcggtaaagttgttgtcatgtgaccaaaaggtcacgggttcaagtcctagaaacagcctcttgtgtaaaaaaataggataagg |
54730305 |
T |
 |
| Q |
238 |
ctgcgtacaatacacca--aatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccg |
306 |
Q |
| |
|
||||||| ||||||||| |||| ||| ||||||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
54730306 |
ctgcgtataatacaccaataatgatggaaccccttcccggaccctgcgtatgcgggagctttagtgcaccg |
54730376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 89; E-Value: 1e-42
Query Start/End: Original strand, 201 - 317
Target Start/End: Complemental strand, 20639777 - 20639658
Alignment:
| Q |
201 |
gtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaa-tggtgggaccccttcccggaccctgcatatgcgggagctct |
297 |
Q |
| |
|
|||||| |||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||| | |
|
|
| T |
20639777 |
gtcctggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaaatggtgggaccccttcccggaccctgcgtatgcgggagcttt |
20639678 |
T |
 |
| Q |
298 |
agtgcaccgggttgcccttt |
317 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
20639677 |
agtgcaccgggttgcccttt |
20639658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 89; E-Value: 1e-42
Query Start/End: Original strand, 170 - 295
Target Start/End: Original strand, 25463108 - 25463235
Alignment:
| Q |
170 |
ttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaaca--gggtaaggctgcgtacaatacaccaaatggtgggaccc |
267 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| ||||| |||||||||||||| | ||| |||| ||||||||| ||||||||||||||||||| |
|
|
| T |
25463108 |
ttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaaaactgggaaaggttgcgtacaacacaccaaatggtgggaccc |
25463207 |
T |
 |
| Q |
268 |
cttcccggaccctgcatatgcgggagct |
295 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
25463208 |
cttcccggaccctgcatatgcgggagct |
25463235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 88; E-Value: 5e-42
Query Start/End: Original strand, 141 - 317
Target Start/End: Original strand, 14983791 - 14983969
Alignment:
| Q |
141 |
gggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaaca--gggtaaggc |
238 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||| | |||||||||| |||||||| | |||||||||||||||||||| | |||||||| |
|
|
| T |
14983791 |
gggtaaccttggcagaactggtaaagttgttgtcatatgattggaaggtcacggattcaagtctttgaaacagcctcttgtgtaaaaaatagggtaaggt |
14983890 |
T |
 |
| Q |
239 |
tgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
||| |||||||||| ||||||||||||||||||||||||||||| |||||||||||| ||||| ||| |||||||||| |
|
|
| T |
14983891 |
tgcctacaatacactaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgcccttt |
14983969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 88; E-Value: 5e-42
Query Start/End: Original strand, 159 - 307
Target Start/End: Original strand, 19027823 - 19027973
Alignment:
| Q |
159 |
tggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaa |
256 |
Q |
| |
|
||||| ||||||||||| |||||| ||||||||||||||||||||||| ||||| | |||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
19027823 |
tggtagagttgttgtcacgtgactgaaaggtcacgggttcaagtcctggaaacaacatcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaat |
19027922 |
T |
 |
| Q |
257 |
tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgg |
307 |
Q |
| |
|
|||||||||||||| || ||| |||| |||| ||||||| ||||||||||| |
|
|
| T |
19027923 |
tggtgggacccctttccagactctgcgtatgtgggagctttagtgcaccgg |
19027973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 86; E-Value: 7e-41
Query Start/End: Original strand, 138 - 317
Target Start/End: Complemental strand, 55766647 - 55766466
Alignment:
| Q |
138 |
gaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacggg-ttcaagtcctgaaaacagcctcttgtgta-aaacagggtaa |
235 |
Q |
| |
|
|||||||||||||| ||| ||||||||||||||||||||||||| ||||||||||| ||||||| || |||||| |||||||| ||||||||||| |
|
|
| T |
55766647 |
gaggggtaaccttgacgcaactggtaaagttgttgtcatgtgaccggaaggtcacggggttcaagttttggaaacagtttcttgtgtgtaaacagggtaa |
55766548 |
T |
 |
| Q |
236 |
ggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
||||||||||||||||| |||||||| ||||| ||||||||| ||| |||||| ||||| |||||||||||| |||||||| |
|
|
| T |
55766547 |
ggctgcgtacaatacactgaatggtggaaccccatcccggaccttgcgtatgcgagagctttagtgcaccgggatgcccttt |
55766466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 84; E-Value: 1e-39
Query Start/End: Original strand, 136 - 266
Target Start/End: Original strand, 14590789 - 14590922
Alignment:
| Q |
136 |
ctgaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt---aaaacaggg |
232 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||||||||||||||| ||||||||||| |||||||||| |||||||||||||| | ||||||||| |
|
|
| T |
14590789 |
ctgagtggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacggattcaagtcctagaaacagcctcttgtctaaaaaaacaggg |
14590888 |
T |
 |
| Q |
233 |
taaggctgcgtacaatacaccaaatggtgggacc |
266 |
Q |
| |
|
||||||||| ||||||||| |||||||||||||| |
|
|
| T |
14590889 |
taaggctgcatacaatacatcaaatggtgggacc |
14590922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 83; E-Value: 5e-39
Query Start/End: Original strand, 148 - 306
Target Start/End: Complemental strand, 30496491 - 30496333
Alignment:
| Q |
148 |
cttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaaggctgcgtacaa |
247 |
Q |
| |
|
|||||||| |||| ||||||||||||| |||||| |||||||||| ||||||||| || ||||||||||||||||||| |||||||||||| ||||| |
|
|
| T |
30496491 |
cttggcgcaactgtaaaagttgttgtcacgtgactgaaaggtcacgtgttcaagtcatggaaacagcctcttgtgtaaacacgggtaaggctgcatacaa |
30496392 |
T |
 |
| Q |
248 |
tacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccg |
306 |
Q |
| |
|
|||||||||||| ||||| |||||||||||| ||| |||| |||||| |||||||||| |
|
|
| T |
30496391 |
tacaccaaatggggggactccttcccggaccgtgcttatgatggagctttagtgcaccg |
30496333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 83; E-Value: 5e-39
Query Start/End: Original strand, 139 - 314
Target Start/End: Original strand, 54966977 - 54967151
Alignment:
| Q |
139 |
aggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaag |
236 |
Q |
| |
|
||||| ||||||||||| || ||||||||||||||||||||||| ||||||||| |||||||| ||| ||| | |||||||||||||| ||||||||| |
|
|
| T |
54966977 |
agggggaaccttggcgcaac-ggtaaagttgttgtcatgtgactgaaaggtcacatgttcaagttctggaaagaacctcttgtgtaaaaaacagggtaag |
54967075 |
T |
 |
| Q |
237 |
gctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccc |
314 |
Q |
| |
|
| ||| ||||||| |||||||||||||||||||||||| ||||| |||||||||||||| | |||||||||| ||||| |
|
|
| T |
54967076 |
gttgc-tacaatataccaaatggtgggaccccttcccgtaccctacatatgcgggagct-ttgtgcaccgggctgccc |
54967151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 82; E-Value: 2e-38
Query Start/End: Original strand, 188 - 317
Target Start/End: Complemental strand, 10277886 - 10277757
Alignment:
| Q |
188 |
gtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatg |
287 |
Q |
| |
|
||||||||||||| |||| |||||||||||||| ||||| ||| ||||||||||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
10277886 |
gtcacgggttcaaatccttgaaacagcctcttgtataaaataggataaggctgcgtacaatacaccaaatggtgaaaccccttcccagaccctgcatatg |
10277787 |
T |
 |
| Q |
288 |
cgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|||||| ||||||| ||||| ||||||||| |
|
|
| T |
10277786 |
cgggagttctagtgaaccggattgcccttt |
10277757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 82; E-Value: 2e-38
Query Start/End: Original strand, 138 - 317
Target Start/End: Original strand, 20405047 - 20405224
Alignment:
| Q |
138 |
gaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa---cagggta |
234 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||||||||||||||| ||||||||||| ||| |||||||||||||||||||| ||||||| |
|
|
| T |
20405047 |
gaggggtaaccttgacgcaactggtaaagttgttgtcatgtgactggaaggtcacggg-------cctagaaacagcctcttgtgtaaaaaaacagggta |
20405139 |
T |
 |
| Q |
235 |
aggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|| |||||||||||||| || |||||||||||||||||||||||| ||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
20405140 |
agattgcgtacaatacactaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcattgggttgcccttt |
20405224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 81; E-Value: 7e-38
Query Start/End: Original strand, 208 - 317
Target Start/End: Original strand, 25629073 - 25629184
Alignment:
| Q |
208 |
aaacagcctcttgtgtaaaaca--gggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcacc |
305 |
Q |
| |
|
|||||| ||||||||||||| | ||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
25629073 |
aaacagtctcttgtgtaaaaaatagggtaaggctgtgtacaatacaccaaatggtgggaccccttcccggaccctacatatgcgggagctttagtgcacc |
25629172 |
T |
 |
| Q |
306 |
gggttgcccttt |
317 |
Q |
| |
|
|||||||||||| |
|
|
| T |
25629173 |
gggttgcccttt |
25629184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 80; E-Value: 3e-37
Query Start/End: Original strand, 160 - 295
Target Start/End: Complemental strand, 39029220 - 39029082
Alignment:
| Q |
160 |
ggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaaggctgcgtacaatacac-caaa |
256 |
Q |
| |
|
||||||||||||||| |||||||||||||||| |||||||| | || |||||||||||||||| ||||||||||||||||| ||||||||||| ||| |
|
|
| T |
39029220 |
ggtaaagttgttgtcgtgtgactaaaaggtcataggttcaagccttggaaacagcctcttgtgtaaaaaacagggtaaggctgtgtacaatacacgaaaa |
39029121 |
T |
 |
| Q |
257 |
tggtgggaccccttcccggaccctgcatatgcgggagct |
295 |
Q |
| |
|
|||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
39029120 |
tggtgggaccactttccggaccctgcatatgcgggagct |
39029082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 78; E-Value: 4e-36
Query Start/End: Original strand, 162 - 318
Target Start/End: Complemental strand, 32478942 - 32478791
Alignment:
| Q |
162 |
taaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa-cagggtaaggctgcgtacaatacaccaaatggt |
260 |
Q |
| |
|
|||||||||||||||||||| | ||||||| ||||||||||||| ||||| ||||| |||||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
32478942 |
taaagttgttgtcatgtgaccgagaggtcacaggttcaagtcctggaaacaacctctagtgtaaaaacagggtaaggctg-----aatacaccaaatggt |
32478848 |
T |
 |
| Q |
261 |
gggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttta |
318 |
Q |
| |
|
||||||||||||||||||| || |||||||||||| | ||||||||||| |||||||| |
|
|
| T |
32478847 |
gggaccccttcccggacccagcgtatgcgggagct-ttgtgcaccgggtggcccttta |
32478791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 78; E-Value: 4e-36
Query Start/End: Original strand, 138 - 317
Target Start/End: Complemental strand, 55830902 - 55830721
Alignment:
| Q |
138 |
gaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgg-gttcaagtcctgaaaacagcctcttgtgta-aaacagggtaa |
235 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||||||||||||| |||||||||| |||||||| || |||||| ||||||||| ||||||||||| |
|
|
| T |
55830902 |
gaggggtaaccttgacgcaactggtaaagttgttgtcatgtgatcggaaggtcacggagttcaagttttggaaacagtctcttgtgtgtaaacagggtaa |
55830803 |
T |
 |
| Q |
236 |
ggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|||||||||||||||| |||||||| ||||| ||||||||| ||| |||||| ||||| ||||||||| || |||||||| |
|
|
| T |
55830802 |
tgctgcgtacaatacactgaatggtggaaccccatcccggaccttgcgtatgcgagagctttagtgcaccaggatgcccttt |
55830721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 76; E-Value: 7e-35
Query Start/End: Original strand, 138 - 314
Target Start/End: Original strand, 10660358 - 10660538
Alignment:
| Q |
138 |
gaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaa |
235 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||| |||||| || |||||||||||| ||||| |||||| ||| |||| |||||| |
|
|
| T |
10660358 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggttacatgttcaagtcctggaaacaacctcttatgtaaaaaatagggtat |
10660457 |
T |
 |
| Q |
236 |
ggctgcgtacaatacacca--aatggtgggaccccttcccggaccctgcatatgcgggagctct-agtgcaccgggttgccc |
314 |
Q |
| |
|
|||||| |||||||||||| ||||||| |||||||||| || ||||| |||||||||||| | |||||| |||||||||| |
|
|
| T |
10660458 |
ggctgcatacaatacaccaataatggtgagaccccttccaaga-cctgcgtatgcgggagctttaagtgcatcgggttgccc |
10660538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 76; E-Value: 7e-35
Query Start/End: Original strand, 138 - 314
Target Start/End: Original strand, 10874503 - 10874683
Alignment:
| Q |
138 |
gaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaa |
235 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||| |||||| || |||||||||||| ||||| |||||| ||| |||| |||||| |
|
|
| T |
10874503 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggttacatgttcaagtcctggaaacaacctcttatgtaaaaaatagggtat |
10874602 |
T |
 |
| Q |
236 |
ggctgcgtacaatacacca--aatggtgggaccccttcccggaccctgcatatgcgggagctct-agtgcaccgggttgccc |
314 |
Q |
| |
|
|||||| |||||||||||| ||||||| |||||||||| || ||||| |||||||||||| | |||||| |||||||||| |
|
|
| T |
10874603 |
ggctgcatacaatacaccaataatggtgagaccccttccaaga-cctgcgtatgcgggagctttaagtgcatcgggttgccc |
10874683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 75; E-Value: 3e-34
Query Start/End: Original strand, 167 - 294
Target Start/End: Complemental strand, 7385628 - 7385499
Alignment:
| Q |
167 |
ttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaaggctgcgtacaatacaccaaatggtggga |
264 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| |||| |||||||||| ||||| |||| ||||||||| || || |||||||||||||||||||| |
|
|
| T |
7385628 |
ttgttgtcatgtgactgaaaggtcacgggttcaagccctggaaacagcctcatgtgtaaaaaatagggtaaggttgtgtgcaatacaccaaatggtggga |
7385529 |
T |
 |
| Q |
265 |
ccccttcccggaccctgcatatgcgggagc |
294 |
Q |
| |
|
||| ||||||||||||| ||||||||||| |
|
|
| T |
7385528 |
ccctttcccggaccctgtgtatgcgggagc |
7385499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 75; E-Value: 3e-34
Query Start/End: Original strand, 227 - 318
Target Start/End: Original strand, 20225119 - 20225212
Alignment:
| Q |
227 |
acagggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttta |
318 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
20225119 |
acagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttgcccttta |
20225212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 75; E-Value: 3e-34
Query Start/End: Original strand, 167 - 304
Target Start/End: Complemental strand, 41018945 - 41018807
Alignment:
| Q |
167 |
ttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa-cagggtaaggctgcgtacaatacaccaaatggtgggac |
265 |
Q |
| |
|
||||||||| |||||| ||||||||||||||||||||||| ||||| |||||||||||||| ||||||||||| ||||||||||||||||| ||||||| |
|
|
| T |
41018945 |
ttgttgtcacgtgactgaaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaattagggtaaggctacgtacaatacaccaaatagtgggac |
41018846 |
T |
 |
| Q |
266 |
cccttcccggaccctgcatatgcgggagctctagtgcac |
304 |
Q |
| |
|
|||||||| |||| ||| |||| || ||| |||||||| |
|
|
| T |
41018845 |
cccttcccagaccttgcgtatggaggggctttagtgcac |
41018807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 74; E-Value: 1e-33
Query Start/End: Original strand, 162 - 301
Target Start/End: Complemental strand, 30581624 - 30581481
Alignment:
| Q |
162 |
taaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt---aaaacagggtaaggctgcgtacaatacacc-aaat |
257 |
Q |
| |
|
|||||||||||||| | |||||||||||| ||||||||||| || ||||| |||||||||| |||||||||||||| || |||||||||||| |||| |
|
|
| T |
30581624 |
taaagttgttgtcacatcactaaaaggtcaagggttcaagtcgtggaaacaacctcttgtgtaaaaaaacagggtaagggtgtgtacaatacaccaaaat |
30581525 |
T |
 |
| Q |
258 |
ggtgggaccccttcccggaccctgcatatgcgggagctctagtg |
301 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
30581524 |
ggtgggaccccttcccggaccctgcatatgtaggagctttagtg |
30581481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 73; E-Value: 4e-33
Query Start/End: Original strand, 202 - 316
Target Start/End: Complemental strand, 7909397 - 7909281
Alignment:
| Q |
202 |
tcctgaaaacagcctcttgtgtaaaa-cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgc-gggagctctag |
299 |
Q |
| |
|
||||| |||||| ||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||| ||||||| ||||| ||||||| ||| |
|
|
| T |
7909397 |
tcctggaaacagtctcttgtgtaaaaacagggtaaggttgcgtacaatacaccaaatggtgggaccccttcccgaaccctgcgtatgcggggagctttag |
7909298 |
T |
 |
| Q |
300 |
tgcaccgggttgccctt |
316 |
Q |
| |
|
|||| |||||||||||| |
|
|
| T |
7909297 |
tgcatcgggttgccctt |
7909281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 73; E-Value: 4e-33
Query Start/End: Original strand, 160 - 281
Target Start/End: Complemental strand, 47441689 - 47441566
Alignment:
| Q |
160 |
ggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaat |
257 |
Q |
| |
|
|||||||||||||||| |||||| ||||||||| ||||||||||| |||||| ||||| ||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
47441689 |
ggtaaagttgttgtcacgtgactgaaaggtcacaggttcaagtccaagaaacagtctcttttgtaaaaatcagggtaaggctgtgtacaatacaccaaat |
47441590 |
T |
 |
| Q |
258 |
ggtgggaccccttcccggaccctg |
281 |
Q |
| |
|
||| |||||||||||||||||||| |
|
|
| T |
47441589 |
ggttggaccccttcccggaccctg |
47441566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 73; E-Value: 4e-33
Query Start/End: Original strand, 163 - 295
Target Start/End: Complemental strand, 49938746 - 49938615
Alignment:
| Q |
163 |
aaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt-aaaacagggtaaggctgcgtacaatacacc-aaatggt |
260 |
Q |
| |
|
||||||||||||| |||||| ||||||||| ||||||||||||| |||||||||||||||| ||||| ||||||| | |||||||||||| ||||||| |
|
|
| T |
49938746 |
aaagttgttgtcacgtgactgaaaggtcacaggttcaagtcctggaaacagcctcttgtgtaaaaacggggtaag---gtgtacaatacaccaaaatggt |
49938650 |
T |
 |
| Q |
261 |
gggaccccttcccggaccctgcatatgcgggagct |
295 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |
|
|
| T |
49938649 |
gggaccccttcccataccctgcatatgcgggagct |
49938615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 73; E-Value: 4e-33
Query Start/End: Original strand, 208 - 317
Target Start/End: Complemental strand, 51865149 - 51865038
Alignment:
| Q |
208 |
aaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcacc |
305 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||| || |||||| |
|
|
| T |
51865149 |
aaacagcctcttgtgtaaaaaacatggtaaggctgcgtacaatacaccaaatggtggggccccttcccggaccctgcgtatgcgggagctttattgcacc |
51865050 |
T |
 |
| Q |
306 |
gggttgcccttt |
317 |
Q |
| |
|
|| |||||||| |
|
|
| T |
51865049 |
ggactgcccttt |
51865038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 72; E-Value: 2e-32
Query Start/End: Original strand, 246 - 317
Target Start/End: Original strand, 38786673 - 38786744
Alignment:
| Q |
246 |
aatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38786673 |
aatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
38786744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 69; E-Value: 1e-30
Query Start/End: Original strand, 196 - 313
Target Start/End: Complemental strand, 9987957 - 9987838
Alignment:
| Q |
196 |
ttcaagtcctgaaaacagcctcttgtgtaaa--acagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggag |
293 |
Q |
| |
|
||||||||||| ||||| ||||||||||||| | ||||||||||||| |||||||||||||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
9987957 |
ttcaagtcctggaaacaacctcttgtgtaaacaatagggtaaggctgcatacaatacaccaaatggtgggaccccttccttgaccttgcatatgcgggag |
9987858 |
T |
 |
| Q |
294 |
ctctagtgcaccgggttgcc |
313 |
Q |
| |
|
|| || ||||||||| |||| |
|
|
| T |
9987857 |
ctttaatgcaccgggctgcc |
9987838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 69; E-Value: 1e-30
Query Start/End: Original strand, 208 - 295
Target Start/End: Original strand, 49796822 - 49796910
Alignment:
| Q |
208 |
aaacagcctcttgtgt-aaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagct |
295 |
Q |
| |
|
|||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
49796822 |
aaacagcctcttgtgttaaaacatggtaaggctgcgtacaatacaccaaatggtgggaccccttcccgaaccctgcgtatgcgggagct |
49796910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 160 - 317
Target Start/End: Complemental strand, 20908797 - 20908636
Alignment:
| Q |
160 |
ggtaaagttgttgtcatgtgact-aaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacag--ggtaaggctgcgtacaatacaccaaa |
256 |
Q |
| |
|
||||||||||||||||||||||| |||| || || ||||||||| || ||||| | |||| | ||||| || |||||||||||||||||||||||||| |
|
|
| T |
20908797 |
ggtaaagttgttgtcatgtgactgaaaatgttacatgttcaagtcatggaaacatcgtcttttctaaaaaagaaggtaaggctgcgtacaatacaccaaa |
20908698 |
T |
 |
| Q |
257 |
-tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||||||||| |||||||| || |||||||| |
|
|
| T |
20908697 |
atggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcacaaggctgcccttt |
20908636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 160 - 308
Target Start/End: Complemental strand, 487294 - 487135
Alignment:
| Q |
160 |
ggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtg--taaaacagggtaaggctgcgtacaatacaccaa-- |
255 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||| || ||||| ||||||||| ||||||| ||||| |||||||||||||||| || |
|
|
| T |
487294 |
ggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcttggaaacaacctcttgtgtataaaacaaggtaaagctgcgtacaatacactaaaa |
487195 |
T |
 |
| Q |
256 |
-------atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccggg |
308 |
Q |
| |
|
|||| |||||||||||||||| |||| ||||||||||| |||||||||||| |
|
|
| T |
487194 |
tggtgggatggcgggaccccttcccggattctgcgaatgcgggagctttagtgcaccggg |
487135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 161 - 295
Target Start/End: Complemental strand, 3580994 - 3580862
Alignment:
| Q |
161 |
gtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatg |
258 |
Q |
| |
|
|||||||||||||||||||||| ||| |||||| ||||||||| |||| |||||||||||||| || |||||||||| || |||||||||||||| |
|
|
| T |
3580994 |
gtaaagttgttgtcatgtgactgaaaagtcacgagttcaagtctggaaa----cctcttgtgtaaaaaccatggtaaggctgtgtgcaatacaccaaatg |
3580899 |
T |
 |
| Q |
259 |
gtgggaccccttcccggaccctgcatatgcgggagct |
295 |
Q |
| |
|
| |||||||||||||||||||||||||| ||||||| |
|
|
| T |
3580898 |
ctaggaccccttcccggaccctgcatatgtgggagct |
3580862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 172 - 317
Target Start/End: Original strand, 7038041 - 7038187
Alignment:
| Q |
172 |
gtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaaggctgcgtacaatacacc-aaatggtgggacccc |
268 |
Q |
| |
|
||||||||||| ||||||||| ||||||||||||| ||||||| |||||||| |||| |||||||| || ||||||||||||| |||||||||| | || |
|
|
| T |
7038041 |
gtcatgtgactgaaaggtcacaggttcaagtcctg-aaacagcttcttgtgtaaaaaatagggtaagacttcgtacaatacaccaaaatggtggggcacc |
7038139 |
T |
 |
| Q |
269 |
ttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
| |||||||||||| ||| | |||||| |||||||| |||||||||||| |
|
|
| T |
7038140 |
tacccggaccctgcgtatac-ggagctttagtgcactgggttgcccttt |
7038187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #59
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 141 - 241
Target Start/End: Complemental strand, 17315476 - 17315375
Alignment:
| Q |
141 |
gggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt-aaaacagggtaaggct |
239 |
Q |
| |
|
||||||||||||||| || ||||||||||||||||||||||| ||||||||||||||||| |||| ||||| |||||||||| |||||| ||||||||| |
|
|
| T |
17315476 |
gggtaaccttggcgcaaccggtaaagttgttgtcatgtgactgaaaggtcacgggttcaattcctcgaaacaacctcttgtgtaaaaacaaggtaaggct |
17315377 |
T |
 |
| Q |
240 |
gc |
241 |
Q |
| |
|
|| |
|
|
| T |
17315376 |
gc |
17315375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #60
Raw Score: 61; E-Value: 6e-26
Query Start/End: Original strand, 196 - 312
Target Start/End: Original strand, 21489099 - 21489218
Alignment:
| Q |
196 |
ttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaa-tggtgggaccccttcccggaccctgcatatgcggga |
292 |
Q |
| |
|
||||||||||| ||||||||||||| |||||| ||| ||||| ||||||||||| ||||||| |||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
21489099 |
ttcaagtcctggaaacagcctcttgcgtaaaaaacagagtaagactgcgtacaatgcaccaaaatggtgggaccccttcccgaaccctgcgtatgcggga |
21489198 |
T |
 |
| Q |
293 |
gctctagtgcaccgggttgc |
312 |
Q |
| |
|
||| | |||||| ||||||| |
|
|
| T |
21489199 |
gctttcgtgcactgggttgc |
21489218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #61
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 159 - 314
Target Start/End: Original strand, 25343162 - 25343321
Alignment:
| Q |
159 |
tggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaaggctgcgtacaatacacc--a |
254 |
Q |
| |
|
||||||||||||||||| |||||| | ||||||| ||||||||| ||| ||| || ||||||||| |||||||||||||||||||||||||||||| | |
|
|
| T |
25343162 |
tggtaaagttgttgtcacgtgactgataggtcacaggttcaagttctggaaatagtctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaa |
25343261 |
T |
 |
| Q |
255 |
aatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccc |
314 |
Q |
| |
|
|| ||| ||||||||||| || ||||| |||| | ||||| ||| ||||| || ||||| |
|
|
| T |
25343262 |
aagggttggaccccttcctagatcctgcgtatgtgagagctttagagcacccggctgccc |
25343321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #62
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 256 - 317
Target Start/End: Original strand, 32484307 - 32484368
Alignment:
| Q |
256 |
atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
32484307 |
atggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcccttt |
32484368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #63
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 255 - 319
Target Start/End: Complemental strand, 38755970 - 38755906
Alignment:
| Q |
255 |
aatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttaa |
319 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
38755970 |
aatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttaa |
38755906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #64
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 160 - 242
Target Start/End: Complemental strand, 42164307 - 42164224
Alignment:
| Q |
160 |
ggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt-aaaacagggtaaggctgcg |
242 |
Q |
| |
|
|||||| |||||||||||||||| |||||||||||||||||||| || ||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
42164307 |
ggtaaaattgttgtcatgtgactgaaaggtcacgggttcaagtcttggaaacaacctcttgtgtaaaaacagggtaaggctgcg |
42164224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #65
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 253 - 319
Target Start/End: Original strand, 11394923 - 11394989
Alignment:
| Q |
253 |
caaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttaa |
319 |
Q |
| |
|
|||||||||||||||||| ||||||||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
11394923 |
caaatggtgggacccctttccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttaa |
11394989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #66
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 253 - 319
Target Start/End: Original strand, 11404650 - 11404716
Alignment:
| Q |
253 |
caaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttaa |
319 |
Q |
| |
|
|||||||||||||||||| ||||||||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
11404650 |
caaatggtgggacccctttccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttaa |
11404716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #67
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 169 - 293
Target Start/End: Complemental strand, 32629418 - 32629293
Alignment:
| Q |
169 |
gttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgt-gtaaaacagggtaaggctgcgtacaatacaccaaa-tggtgggacc |
266 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| |||| |||||||||||||| ||||||||||||||| || ||| |||||||||| ||| |||||| |
|
|
| T |
32629418 |
gttgtcatgtgactgaaaggtcacgggttcaaatcctcgaaacagcctcttgtaaaaaaacagggtaaggccgcctac-atacaccaaattggcgggacc |
32629320 |
T |
 |
| Q |
267 |
ccttcccggaccctgcatatgcgggag |
293 |
Q |
| |
|
|||||||||||| ||| |||| ||||| |
|
|
| T |
32629319 |
ccttcccggaccttgcgtatgtgggag |
32629293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #68
Raw Score: 54; E-Value: 9e-22
Query Start/End: Original strand, 141 - 214
Target Start/End: Complemental strand, 5313172 - 5313099
Alignment:
| Q |
141 |
gggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagc |
214 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| | ||||||||||||||||| ||||||||||||| |
|
|
| T |
5313172 |
gggtaaccttggcgtaactggtaaagttgttgtcatgtgattgaaaggtcacgggttcaattcctgaaaacagc |
5313099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #69
Raw Score: 54; E-Value: 9e-22
Query Start/End: Original strand, 243 - 317
Target Start/End: Complemental strand, 33836563 - 33836487
Alignment:
| Q |
243 |
tacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||| |||||||||||| ||||||| ||||||||||||| |
|
|
| T |
33836563 |
tacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaacgggttgcccttt |
33836487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #70
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 256 - 320
Target Start/End: Complemental strand, 40553998 - 40553934
Alignment:
| Q |
256 |
atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttaat |
320 |
Q |
| |
|
|||||| |||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
40553998 |
atggtgtgaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttaat |
40553934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #71
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 162 - 317
Target Start/End: Complemental strand, 23580365 - 23580208
Alignment:
| Q |
162 |
taaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaaggctgcgtacaatacacc-aaatg |
258 |
Q |
| |
|
|||||||||||||| |||||| ||||||||||||||||||| || ||| |||||||||||| ||||||||| ||| ||||||| ||||||| ||||| |
|
|
| T |
23580365 |
taaagttgttgtcacgtgactgaaaggtcacgggttcaagttctagaaagagcctcttgtgtaaaaaacaggggaagactgcgtaggatacaccaaaatg |
23580266 |
T |
 |
| Q |
259 |
gtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
| | ||||||||| ||| |||| |||| ||||||| |||||||||| | |||||||| |
|
|
| T |
23580265 |
gcgagaccccttcttgga-cctgtgtatgtgggagctttagtgcaccgagctgcccttt |
23580208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #72
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 224 - 317
Target Start/End: Complemental strand, 36816478 - 36816384
Alignment:
| Q |
224 |
aaaacagggtaaggctgcgtacaatacaccaaat-ggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
||||||||| | ||||||||||||||||||||| |||||||| |||||| |||||||| |||||||||||| ||||| ||||||||||||||| |
|
|
| T |
36816478 |
aaaacagggcagggctgcgtacaatacaccaaaaaggtgggactccttcctggaccctgtgtatgcgggagctttagtgtaccgggttgcccttt |
36816384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #73
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 253 - 313
Target Start/End: Original strand, 28494222 - 28494282
Alignment:
| Q |
253 |
caaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcc |
313 |
Q |
| |
|
||||||||||||||||||||| || ||||||||||||||||||||||||||||||| |||| |
|
|
| T |
28494222 |
caaatggtgggaccccttcccagatcctgcatatgcgggagctctagtgcaccgggctgcc |
28494282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #74
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 160 - 241
Target Start/End: Original strand, 43035224 - 43035307
Alignment:
| Q |
160 |
ggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgta--aaacagggtaaggctgc |
241 |
Q |
| |
|
|||||||||||||||| |||||| ||||||||||||||||||||| | ||||| ||||||||||| ||||| ||||||||||| |
|
|
| T |
43035224 |
ggtaaagttgttgtcacgtgactgaaaggtcacgggttcaagtccaggaaacaacctcttgtgtaagaaacacggtaaggctgc |
43035307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #75
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 255 - 318
Target Start/End: Original strand, 25388249 - 25388312
Alignment:
| Q |
255 |
aatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttta |
318 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| ||||| |||||||||||||||||||||| |
|
|
| T |
25388249 |
aatggtgggaccccttcccggaccctgcgtatgcatgagctttagtgcaccgggttgcccttta |
25388312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #76
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 147 - 314
Target Start/End: Original strand, 36589708 - 36589876
Alignment:
| Q |
147 |
ccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaaggctgcgta |
244 |
Q |
| |
|
||||||||| || |||||||||| ||||| ||||| ||| ||| | ||||||||||||| |||||||||||||||| |||||| ||||| |||| | |
|
|
| T |
36589708 |
ccttggcgcaac-ggtaaagttgatgtcacatgactgaaacgtc-caggttcaagtcctggaaacagcctcttgtgtaaaaaacatggtaatgctgttga |
36589805 |
T |
 |
| Q |
245 |
caatacacc-aaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccc |
314 |
Q |
| |
|
|| |||||| ||||||||||||||||||| | ||||| |||||||||||| | |||||||||| ||||| |
|
|
| T |
36589806 |
cagtacaccaaaatggtgggaccccttcctgaaccctatgtatgcgggagctttggtgcaccgggctgccc |
36589876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #77
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 224 - 318
Target Start/End: Complemental strand, 48327858 - 48327762
Alignment:
| Q |
224 |
aaaacagggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttta |
318 |
Q |
| |
|
||||||||||||| |||| ||||||||||||| ||||||||||| ||||||| |||| ||||||||| || | |||||||||||||| ||||||| |
|
|
| T |
48327858 |
aaaacagggtaagactgcatacaatacaccaataatggtgggacctcttcccgaaccccacatatgcggaagttttagtgcaccgggttacccttta |
48327762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #78
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 147 - 227
Target Start/End: Complemental strand, 54640510 - 54640431
Alignment:
| Q |
147 |
ccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa |
227 |
Q |
| |
|
||||||||| || |||||| ||||||||| ||| || |||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
54640510 |
ccttggcgcaac-ggtaaaattgttgtcacgtggctgaaaggtcacgggttcaagtcttggaaacagcctcttgtgtaaaa |
54640431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #79
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 267 - 317
Target Start/End: Original strand, 35532077 - 35532127
Alignment:
| Q |
267 |
ccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|||||||||||||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
35532077 |
ccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
35532127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #80
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 256 - 318
Target Start/End: Original strand, 44718641 - 44718703
Alignment:
| Q |
256 |
atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttta |
318 |
Q |
| |
|
|||||||||||||||||| |||||||| |||||||||||| ||| ||||||||||||||||| |
|
|
| T |
44718641 |
atggtgggaccccttcccagaccctgcgtatgcgggagctttagcacaccgggttgcccttta |
44718703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #81
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 224 - 316
Target Start/End: Complemental strand, 12711542 - 12711450
Alignment:
| Q |
224 |
aaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctt |
316 |
Q |
| |
|
|||| |||||||| |||||||||||||||||||||| ||||||||||| | |||| || ||||||| | || ||||||||| ||||||||| |
|
|
| T |
12711542 |
aaaatagggtaagactgcgtacaatacaccaaatggcgggaccccttctcagacctagcgtatgcggaaactttagtgcacccagttgccctt |
12711450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #82
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 223 - 308
Target Start/End: Original strand, 16494258 - 16494345
Alignment:
| Q |
223 |
taaaacagggtaaggctgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccggg |
308 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||| ||||||||||| ||||| ||||||| ||||||| |||| ||||| |||||| |
|
|
| T |
16494258 |
taaaacagggtaaagctgcatacaatacaccaaaaatggtgggaccctttcccagaccctgtgtatgcggaagctttagtgtaccggg |
16494345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #83
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 163 - 265
Target Start/End: Complemental strand, 49938594 - 49938490
Alignment:
| Q |
163 |
aaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt-aaaacagggtaaggctgcgtacaataca-ccaaatggt |
260 |
Q |
| |
|
||||||||||||| |||||| ||||||||| | |||||||| || || |||| | |||||| |||||||||||||||||||| |||| || | ||||||| |
|
|
| T |
49938594 |
aaagttgttgtcacgtgactgaaaggtcacagattcaagtcttggaagcagcgtattgtgtaaaaacagggtaaggctgcgtccaattcatcaaaatggt |
49938495 |
T |
 |
| Q |
261 |
gggac |
265 |
Q |
| |
|
||||| |
|
|
| T |
49938494 |
gggac |
49938490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #84
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 226 - 317
Target Start/End: Original strand, 2813169 - 2813263
Alignment:
| Q |
226 |
aacagggtaaggctgcgtacaatacacca--aatggtgggaccccttcccggaccctgcatatgcgggagctct-agtgcaccgggttgcccttt |
317 |
Q |
| |
|
||||||||||| |||||||||||||| || ||||||||||||| |||||| || ||| |||||||||||| | |||||||||| ||||||||| |
|
|
| T |
2813169 |
aacagggtaagactgcgtacaatacatcaataatggtgggaccctttcccgaacgatgcgtatgcgggagctttaagtgcaccggattgcccttt |
2813263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #85
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 254 - 317
Target Start/End: Complemental strand, 47482913 - 47482850
Alignment:
| Q |
254 |
aaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||| | ||||| || | |||||||| |
|
|
| T |
47482913 |
aaatggtgggaccccttcccggaccctgcgtatgcgggagctttggtgcaacgagctgcccttt |
47482850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #86
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 147 - 254
Target Start/End: Original strand, 51420537 - 51420646
Alignment:
| Q |
147 |
ccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacggg-ttcaagtcctgaaaacagcctcttgtgta--aaacagggtaaggctgcgt |
243 |
Q |
| |
|
||||||||| || ||| |||||||||||| |||||| |||||||| | |||||||| || ||||| ||||||||||| |||||||||||||||| || |
|
|
| T |
51420537 |
ccttggcgcaac-ggtgaagttgttgtcacgtgactgaaaggtcagttgattcaagtcatggaaacaacctcttgtgtagaaaacagggtaaggctgggt |
51420635 |
T |
 |
| Q |
244 |
acaatacacca |
254 |
Q |
| |
|
||||||||||| |
|
|
| T |
51420636 |
acaatacacca |
51420646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #87
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 266 - 317
Target Start/End: Original strand, 56322984 - 56323035
Alignment:
| Q |
266 |
cccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|||||||||||||| | ||||||||||||| ||||||||||||||||||||| |
|
|
| T |
56322984 |
cccttcccggaccccggatatgcgggagctttagtgcaccgggttgcccttt |
56323035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #88
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 255 - 317
Target Start/End: Complemental strand, 50555718 - 50555656
Alignment:
| Q |
255 |
aatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|||||||| ||||||||||||||||||| ||||| |||| | |||||||||||| |||||||| |
|
|
| T |
50555718 |
aatggtggaaccccttcccggaccctgcgtatgcaggagttttagtgcaccgggctgcccttt |
50555656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #89
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 160 - 224
Target Start/End: Complemental strand, 12257752 - 12257688
Alignment:
| Q |
160 |
ggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgta |
224 |
Q |
| |
|
|||||||||||||||| |||| | ||||||||||||||||| |||| ||||||| ||||||||| |
|
|
| T |
12257752 |
ggtaaagttgttgtcacgtgattgaaaggtcacgggttcaaatcctagaaacagcgtcttgtgta |
12257688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #90
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 141 - 181
Target Start/End: Original strand, 18969698 - 18969738
Alignment:
| Q |
141 |
gggtaaccttggcgccactggtaaagttgttgtcatgtgac |
181 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
18969698 |
gggtaaccttggcgcaactggtaaagttgttgtcatgtgac |
18969738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #91
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 257 - 317
Target Start/End: Original strand, 19027986 - 19028046
Alignment:
| Q |
257 |
tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
||||||||| ||||||||||||| | |||||||||||| |||||||||||| |||||||| |
|
|
| T |
19027986 |
tggtgggactccttcccggaccccacttatgcgggagctttagtgcaccgggctgcccttt |
19028046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #92
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 193 - 277
Target Start/End: Complemental strand, 17079777 - 17079691
Alignment:
| Q |
193 |
gggttcaagtcctgaaaacagcctcttgtgta--aaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggac |
277 |
Q |
| |
|
||||||||||| || ||||| ||||||||| ||||||||||||||||| |||||||| | |||||||||||||| |||| |||| |
|
|
| T |
17079777 |
gggttcaagtcttggaaacaatatcttgtgtataaaacagggtaaggctgcatacaatacgctaaatggtgggaccctttcctggac |
17079691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #93
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 137 - 192
Target Start/End: Complemental strand, 29879679 - 29879624
Alignment:
| Q |
137 |
tgaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcac |
192 |
Q |
| |
|
||||||||||| |||| || |||| |||||||||||||||||||||| |||||||| |
|
|
| T |
29879679 |
tgaggggtaacattggtgcaactgataaagttgttgtcatgtgactagaaggtcac |
29879624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #94
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 160 - 230
Target Start/End: Original strand, 41549358 - 41549428
Alignment:
| Q |
160 |
ggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacag |
230 |
Q |
| |
|
||||||||||||| || ||| | ||| ||||||||||||||| ||| ||||| ||||||||||||||||| |
|
|
| T |
41549358 |
ggtaaagttgttgacacatgattgaaatgtcacgggttcaagttctggaaacaacctcttgtgtaaaacag |
41549428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #95
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 175 - 263
Target Start/End: Complemental strand, 10380086 - 10379997
Alignment:
| Q |
175 |
atgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaac-agggtaaggctgcgtacaatacaccaaatggtggg |
263 |
Q |
| |
|
|||||||| ||||||||| ||||||||||| ||||| |||||||||||||| ||| ||| ||||||||||||||||||| ||||| |
|
|
| T |
10380086 |
atgtgactgaaaggtcacttgttcaagtcctacaaacaacctcttgtgtaaaaataggataaaattgcgtacaatacaccaaatagtggg |
10379997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #96
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 224 - 276
Target Start/End: Complemental strand, 35894555 - 35894502
Alignment:
| Q |
224 |
aaaacagggtaaggctgcgtacaatacaccaaa-tggtgggaccccttcccgga |
276 |
Q |
| |
|
|||||| |||||| |||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
35894555 |
aaaacacggtaagtgtgcgtacaatacaccaaaatggtgggaccccttcccgga |
35894502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #97
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 159 - 280
Target Start/End: Original strand, 44357195 - 44357319
Alignment:
| Q |
159 |
tggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgta--aaacagggtaaggctgcgtacaatacacc-aa |
255 |
Q |
| |
|
|||||||||| |||| |||| ||| |||||||| | ||||||||||| ||||| ||| ||||||| ||| || ||||| | ||||||||||||| || |
|
|
| T |
44357195 |
tggtaaagttattgttatgtaactgaaaggtcatgagttcaagtcctagaaacaaccttttgtgtaataaatagagtaagacgacgtacaatacaccaaa |
44357294 |
T |
 |
| Q |
256 |
atggtgggaccccttcccggaccct |
280 |
Q |
| |
|
|||| |||||| |||||| |||||| |
|
|
| T |
44357295 |
atggcgggacctcttcccagaccct |
44357319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #98
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 224 - 294
Target Start/End: Original strand, 46082785 - 46082856
Alignment:
| Q |
224 |
aaaacagggtaaggctgcgtacaatacacca-aatggtgggaccccttcccggaccctgcatatgcgggagc |
294 |
Q |
| |
|
|||| ||| |||||||||||| |||||| | ||||||| ||| ||||| |||||||||||||||||||||| |
|
|
| T |
46082785 |
aaaataggttaaggctgcgtattatacacaataatggtgagactccttctcggaccctgcatatgcgggagc |
46082856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #99
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 232 - 274
Target Start/End: Complemental strand, 4222113 - 4222071
Alignment:
| Q |
232 |
gtaaggctgcgtacaatacaccaaatggtgggaccccttcccg |
274 |
Q |
| |
|
||||||||||||| ||||||| || |||||||||||||||||| |
|
|
| T |
4222113 |
gtaaggctgcgtagaatacacaaattggtgggaccccttcccg |
4222071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #100
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 147 - 205
Target Start/End: Complemental strand, 50856407 - 50856350
Alignment:
| Q |
147 |
ccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcct |
205 |
Q |
| |
|
||||||||| || |||||||||||||||| ||| | |||||||||||||||||||||| |
|
|
| T |
50856407 |
ccttggcgcaac-ggtaaagttgttgtcacatgattgaaaggtcacgggttcaagtcct |
50856350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #101
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 255 - 303
Target Start/End: Original strand, 8820581 - 8820629
Alignment:
| Q |
255 |
aatggtgggaccccttcccggaccctgcatatgcgggagctctagtgca |
303 |
Q |
| |
|
||||||||||||||||||| |||||||| |||||| ||| | ||||||| |
|
|
| T |
8820581 |
aatggtgggaccccttcccagaccctgcgtatgcgagagttttagtgca |
8820629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #102
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 260 - 316
Target Start/End: Complemental strand, 12666914 - 12666858
Alignment:
| Q |
260 |
tgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctt |
316 |
Q |
| |
|
||||||||||| |||||| ||| ||||| |||||| |||| ||||||||||||||| |
|
|
| T |
12666914 |
tgggaccccttgtcggaccatgcgtatgcaggagctttagtacaccgggttgccctt |
12666858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0168 (Bit Score: 160; Significance: 5e-85; HSPs: 1)
Name: scaffold0168
Description:
Target: scaffold0168; HSP #1
Raw Score: 160; E-Value: 5e-85
Query Start/End: Original strand, 138 - 317
Target Start/End: Original strand, 30533 - 30712
Alignment:
| Q |
138 |
gaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaagg |
237 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||| ||||||||| ||||||||||||| ||||||||||||||||||||||||||| || |
|
|
| T |
30533 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcaccggttcaagtcctggaaacagcctcttgtgtaaaacagggtaggg |
30632 |
T |
 |
| Q |
238 |
ctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30633 |
ctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
30712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 157; Significance: 3e-83; HSPs: 81)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 157; E-Value: 3e-83
Query Start/End: Original strand, 137 - 317
Target Start/End: Complemental strand, 21779441 - 21779261
Alignment:
| Q |
137 |
tgaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaag |
236 |
Q |
| |
|
||||||||||||||||||| |||||| ||||||||||||||||||| ||||||||||||||||||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
21779441 |
tgaggggtaaccttggcgcaactggtgaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggagacagcctcttgtgtaaaacagggtaag |
21779342 |
T |
 |
| Q |
237 |
gctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21779341 |
gttgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
21779261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 146; E-Value: 1e-76
Query Start/End: Original strand, 137 - 318
Target Start/End: Original strand, 23397719 - 23397900
Alignment:
| Q |
137 |
tgaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaag |
236 |
Q |
| |
|
|||||||||||||||| || |||||||||||||||||||||||||| |||||||| |||||||||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
23397719 |
tgaggggtaaccttggtgcaactggtaaagttgttgtcatgtgactgaaaggtcatgggttcaagtcctggaaacagcctcttgtgtaaaatagggtaag |
23397818 |
T |
 |
| Q |
237 |
gctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttta |
318 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23397819 |
gctacgtacaatacaccaaatggtgggaccccttctcggaccctacatatgcgggagctctagtgcaccgggttgcccttta |
23397900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 143; E-Value: 7e-75
Query Start/End: Original strand, 138 - 317
Target Start/End: Complemental strand, 8455497 - 8455316
Alignment:
| Q |
138 |
gaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaaca--gggtaa |
235 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||| |||||| |
|
|
| T |
8455497 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaacacagggtaa |
8455398 |
T |
 |
| Q |
236 |
ggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||| ||||||||||||||||||||| |
|
|
| T |
8455397 |
ggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgccggagctttagtgcaccgggttgcccttt |
8455316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 141; E-Value: 1e-73
Query Start/End: Original strand, 138 - 317
Target Start/End: Original strand, 9671134 - 9671314
Alignment:
| Q |
138 |
gaggggtaaccttggcgccactggtaaagttgttgtcatgtgacta-aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaag |
236 |
Q |
| |
|
|||||||||||||||||| || ||||||||||||||||||||||| ||| ||||||||||||| ||||| ||||||||||||||||||||||||||||| |
|
|
| T |
9671134 |
gaggggtaaccttggcgcaaccggtaaagttgttgtcatgtgactggaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaacagggtaag |
9671233 |
T |
 |
| Q |
237 |
gctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
9671234 |
gctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
9671314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 136; E-Value: 1e-70
Query Start/End: Original strand, 137 - 318
Target Start/End: Original strand, 14530271 - 14530456
Alignment:
| Q |
137 |
tgaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||| | ||||||||||| |
|
|
| T |
14530271 |
tgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtataaaaaacagggta |
14530370 |
T |
 |
| Q |
235 |
aggctgcgtacaatacacca--aatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttta |
318 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
14530371 |
aggctacgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttta |
14530456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 133; E-Value: 7e-69
Query Start/End: Original strand, 139 - 317
Target Start/End: Original strand, 10543653 - 10543835
Alignment:
| Q |
139 |
aggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaag |
236 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||||||||||||| ||||||||||||||||||||||| |||| ||||||||||| ||||||||||||| |
|
|
| T |
10543653 |
aggggtaaccttggcgcaactgataaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacggcctcttgtgtaaaaaacagggtaag |
10543752 |
T |
 |
| Q |
237 |
gctgcgtacaatacacc--aaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
10543753 |
gctgcgtacaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
10543835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 123; E-Value: 6e-63
Query Start/End: Original strand, 138 - 307
Target Start/End: Complemental strand, 12024099 - 12023929
Alignment:
| Q |
138 |
gaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt-aaaacagggtaag |
236 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||| ||||||||||||| |
|
|
| T |
12024099 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaacagggtaag |
12024000 |
T |
 |
| Q |
237 |
gctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgg |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||| ||| || |||| || |||||||| |
|
|
| T |
12023999 |
gctgcgtacaatacaccaaatggtgggaccccctcccggaccctgcgtatttggaagctttaatgcaccgg |
12023929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 122; E-Value: 2e-62
Query Start/End: Original strand, 141 - 317
Target Start/End: Complemental strand, 25249915 - 25249738
Alignment:
| Q |
141 |
gggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgta-aaacagggtaaggct |
239 |
Q |
| |
|
||||||||||||||| | |||||||||||||||||||||||| ||||||||||||||||||| || |||||| |||||||||| ||||||||||||||| |
|
|
| T |
25249915 |
gggtaaccttggcgcaattggtaaagttgttgtcatgtgactgtaaggtcacgggttcaagtcatggaaacagtctcttgtgtacaaacagggtaaggct |
25249816 |
T |
 |
| Q |
240 |
gcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| ||||||| |||||| ||||| ||||||||||||||||||||| |
|
|
| T |
25249815 |
gcgtacaatacaccaaatggtgggatcccttcccgaaccctgcgtatgcgtgagctttagtgcaccgggttgcccttt |
25249738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 117; E-Value: 2e-59
Query Start/End: Original strand, 140 - 317
Target Start/End: Original strand, 11514392 - 11514570
Alignment:
| Q |
140 |
ggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaagg |
237 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||| ||||| |||||||||||||||| |||||| |||||| |
|
|
| T |
11514392 |
ggggtaaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaactcctggaaacagcctcttgtgtaaaaaacaaagtaagg |
11514491 |
T |
 |
| Q |
238 |
ctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| |||||||| |||||||||||| ||||||||||| ||||||||| |
|
|
| T |
11514492 |
ctgcgtacaatacaccaaatggtggga-cccttcccagaccctgcgtatgcgggagctttagtgcaccggattgcccttt |
11514570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 114; E-Value: 1e-57
Query Start/End: Original strand, 137 - 317
Target Start/End: Complemental strand, 25079900 - 25079717
Alignment:
| Q |
137 |
tgaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa---cagggt |
233 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||| | ||||| |||||||||||||| || ||| |
|
|
| T |
25079900 |
tgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcttagaaacaacctcttgtgtaaaaaaacaaggt |
25079801 |
T |
 |
| Q |
234 |
aaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||||||||||||||||| ||||| ||||| ||||||||||||||||||||| |
|
|
| T |
25079800 |
aaggatgcgtacaatacaccgaatggtgggaccccttcccggaccctgcgtatgcaagagctttagtgcaccgggttgcccttt |
25079717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 113; E-Value: 6e-57
Query Start/End: Original strand, 139 - 317
Target Start/End: Complemental strand, 24200805 - 24200623
Alignment:
| Q |
139 |
aggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaag |
236 |
Q |
| |
|
||||||||||||| || |||||||||||||||||||||||||| ||| ||||||||||||||||||| |||||||||||||||| ||||||||||||| |
|
|
| T |
24200805 |
aggggtaaccttgatgcaactggtaaagttgttgtcatgtgactgaaaagtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaag |
24200706 |
T |
 |
| Q |
237 |
gctgcgtacaatacacc--aaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
||||||||||||||||| ||||||||||| |||||||||||||||| |||| | ||||| ||||||||||||||||||||| |
|
|
| T |
24200705 |
gctgcgtacaatacaccaaaaatggtgggaacccttcccggaccctgagtatgtgagagctttagtgcaccgggttgcccttt |
24200623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 108; E-Value: 5e-54
Query Start/End: Original strand, 175 - 317
Target Start/End: Original strand, 10546153 - 10546298
Alignment:
| Q |
175 |
atgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa---cagggtaaggctgcgtacaatacaccaaatggtgggaccccttc |
271 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| ||||| |||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10546153 |
atgtgactgaaaggtcacgggttcaagtcctggaaacatcctcttgtataaaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttc |
10546252 |
T |
 |
| Q |
272 |
ccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
||||||||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
10546253 |
ccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
10546298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 105; E-Value: 3e-52
Query Start/End: Original strand, 137 - 281
Target Start/End: Original strand, 22371010 - 22371153
Alignment:
| Q |
137 |
tgaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaag |
236 |
Q |
| |
|
||||||||||||||||| | |||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||| ||| ||||||||||||| |
|
|
| T |
22371010 |
tgaggggtaaccttggcccaactggtaaagttgttgtcatgtgactgggaggtcacgggttcaagtcctggaaacagcctcgtgta-aaaacagggtaag |
22371108 |
T |
 |
| Q |
237 |
gctgcgtacaatacaccaaatggtgggaccccttcccggaccctg |
281 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22371109 |
gctgcgtacaatacaccaaatggtgggaccccttcccggaccctg |
22371153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 104; E-Value: 1e-51
Query Start/End: Original strand, 175 - 317
Target Start/End: Original strand, 14444720 - 14444863
Alignment:
| Q |
175 |
atgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa-cagggtaaggctgcgtacaatacaccaaatggtgggaccccttccc |
273 |
Q |
| |
|
|||||||| |||||||||||||||||||||| |||||||||||||||||||| ||||||||||||| |||| ||||||||||||||||||||||||||| |
|
|
| T |
14444720 |
atgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaacagggtaaggctgtgtacgatacaccaaatggtgggaccccttccc |
14444819 |
T |
 |
| Q |
274 |
ggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
||||||||| |||||||||||| ||||||||| ||||||||||| |
|
|
| T |
14444820 |
ggaccctgcgtatgcgggagctttagtgcaccaggttgcccttt |
14444863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 104; E-Value: 1e-51
Query Start/End: Original strand, 157 - 317
Target Start/End: Original strand, 17667975 - 17668137
Alignment:
| Q |
157 |
actggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacacca |
254 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||| ||| | |||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
17667975 |
actggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaagaacctcttgtgtaaaaatcagggtaaggctgcgtacaatacacca |
17668074 |
T |
 |
| Q |
255 |
aatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|||||||| |||||||| || ||||||| ||| ||||||| ||||||||||||||||||||| |
|
|
| T |
17668075 |
aatggtggaaccccttctcgaaccctgcgtatatgggagctttagtgcaccgggttgcccttt |
17668137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 103; E-Value: 5e-51
Query Start/End: Original strand, 140 - 317
Target Start/End: Original strand, 17896215 - 17896395
Alignment:
| Q |
140 |
ggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaaca---gggtaag |
236 |
Q |
| |
|
|||||||||||| ||| ||||||||||||||||||||||||| ||||||||||| |||||||||| ||||| |||||||||||||| | ||||||| |
|
|
| T |
17896215 |
ggggtaaccttgacgcaactggtaaagttgttgtcatgtgaccgaaaggtcacggattcaagtcctagaaacaacctcttgtgtaaaaaaatagggtaag |
17896314 |
T |
 |
| Q |
237 |
gctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| |||||||||| |||| ||||||| ||||||| || |||||||||| |
|
|
| T |
17896315 |
gctgcgtacaatataccaaatggtgggaccccttctcggaccctgcgtatgtgggagctttagtgcatcgagttgcccttt |
17896395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 102; E-Value: 2e-50
Query Start/End: Original strand, 138 - 317
Target Start/End: Original strand, 5840982 - 5841165
Alignment:
| Q |
138 |
gaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaa |
235 |
Q |
| |
|
||||||||||||||| || | || ||||||||||||||||||||| ||||||||||||||||||||| ||||||||| |||||| |||| ||||||| |
|
|
| T |
5840982 |
gaggggtaaccttggtgcaaatgataaagttgttgtcatgtgactggaaggtcacgggttcaagtcctagaaacagccttttgtgtaaaaaatagggtaa |
5841081 |
T |
 |
| Q |
236 |
ggctgcgtacaatacacca--aatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|| ||||||||||||| || ||||||||||||||||||||||||| ||||||||||||||| |||||||||| |||||||||| |
|
|
| T |
5841082 |
ggatgcgtacaatacatcaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgagttgcccttt |
5841165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 96; E-Value: 8e-47
Query Start/End: Original strand, 157 - 317
Target Start/End: Original strand, 17623537 - 17623699
Alignment:
| Q |
157 |
actggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacacca |
254 |
Q |
| |
|
||||||||||||||||||||| |||| ||||||||||||||||||||| ||||| |||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
17623537 |
actggtaaagttgttgtcatgcgactggaaggtcacgggttcaagtcctcgaaacaacctcttgtgtaaaaatcagggtaaggctgcgtacaatacacca |
17623636 |
T |
 |
| Q |
255 |
aatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|||||||| ||||||||||| | ||||| |||| || |||| |||||||| |||||||||||| |
|
|
| T |
17623637 |
aatggtggaaccccttcccgaatcctgcgtatgtggaagctttagtgcactgggttgcccttt |
17623699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 95; E-Value: 3e-46
Query Start/End: Original strand, 144 - 317
Target Start/End: Original strand, 27573581 - 27573755
Alignment:
| Q |
144 |
taaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgta-aaacagggtaaggctgcg |
242 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||| |||||||| ||||||||||| | |||||||||||||||| ||||| |||||||||||| |
|
|
| T |
27573581 |
taaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcattggttcaagtccgggcaacagcctcttgtgtataaacatggtaaggctgcg |
27573680 |
T |
 |
| Q |
243 |
tacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|||||||||||||||||||| ||| ||||| |||||| |||| ||||||| ||||||| ||||||||||||| |
|
|
| T |
27573681 |
tacaatacaccaaatggtggaaccatttcccaaaccctgtgtatgtgggagctttagtgcatcgggttgcccttt |
27573755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 91; E-Value: 8e-44
Query Start/End: Original strand, 200 - 317
Target Start/End: Original strand, 36871509 - 36871626
Alignment:
| Q |
200 |
agtcctgaaaacagcctcttgtgt-aaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctcta |
298 |
Q |
| |
|
||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||| || |
|
|
| T |
36871509 |
agtcctggaaacagcctcttgtgtgaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccgga-cctgcgtatgcgggagcttta |
36871607 |
T |
 |
| Q |
299 |
gtgcaccgggttgcccttt |
317 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
36871608 |
gtgcaccgggttgcccttt |
36871626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 89; E-Value: 1e-42
Query Start/End: Original strand, 140 - 305
Target Start/End: Complemental strand, 19977893 - 19977726
Alignment:
| Q |
140 |
ggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaagg |
237 |
Q |
| |
|
||||||||||||||| |||||| |||||||||||||||||| ||||||||||||||||||| ||| |||||||||||| ||| |||| ||| ||||| |
|
|
| T |
19977893 |
ggggtaaccttggcggaactggtgaagttgttgtcatgtgaccgaaaggtcacgggttcaagttctggaaacagcctcttttgtaaaaaataggataagg |
19977794 |
T |
 |
| Q |
238 |
ctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcacc |
305 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| ||| || |||||||||||| ||||||||| |
|
|
| T |
19977793 |
ttgcgtacaatacaccaaatggtgggatcccttcccgaaccttgtgtatgcgggagctttagtgcacc |
19977726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 89; E-Value: 1e-42
Query Start/End: Original strand, 158 - 317
Target Start/End: Complemental strand, 39914467 - 39914306
Alignment:
| Q |
158 |
ctggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt---aaaacagggtaaggctgcgtacaatacacca |
254 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| |||||| ||| ||||| |||||||||| |||||||||||||| || |||||||||||| |
|
|
| T |
39914467 |
ctggtaaagttgttgtcatgtgactggaaggtcacgggatcaagtactggaaacaacctcttgtgtaaaaaaacagggtaaggatgtgtacaatacaccg |
39914368 |
T |
 |
| Q |
255 |
aatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|||||||||||||||| || |||||||| |||||||||||| ||||||| ||||||||||||| |
|
|
| T |
39914367 |
aatggtgggacccctt-cctgaccctgcgtatgcgggagctttagtgcatcgggttgcccttt |
39914306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 87; E-Value: 2e-41
Query Start/End: Original strand, 159 - 318
Target Start/End: Complemental strand, 40417031 - 40416870
Alignment:
| Q |
159 |
tggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaa |
256 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||| || ||||| |||||||| ||||| ||||| ||||||| |||||||||||||| |
|
|
| T |
40417031 |
tggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcatggaaacaacctcttgtataaaaaacagggaaaggctgtgtacaatacaccaat |
40416932 |
T |
 |
| Q |
257 |
tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttta |
318 |
Q |
| |
|
|| |||||||| || |||||||||||||||| ||||| |||||||||||||||||||||| |
|
|
| T |
40416931 |
tgatgggacccttttttggaccctgcatatgcgagagctttagtgcaccgggttgcccttta |
40416870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 86; E-Value: 7e-41
Query Start/End: Original strand, 138 - 313
Target Start/End: Original strand, 7214488 - 7214667
Alignment:
| Q |
138 |
gaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaa--acagggtaa |
235 |
Q |
| |
|
|||||||||| ||||| | |||||||||||||||||||||||||| |||||||| ||||||||||| || |||||| |||||||||||| ||||||||| |
|
|
| T |
7214488 |
gaggggtaactttggcacaactggtaaagttgttgtcatgtgactgaaaggtcatgggttcaagtcttggaaacagtctcttgtgtaaaatacagggtaa |
7214587 |
T |
 |
| Q |
236 |
ggctgcgtacaatacac--caaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcc |
313 |
Q |
| |
|
||||||||||||||||| |||||||| || |||||| ||||| |||| |||||| ||| | ||||||||| ||||||| |
|
|
| T |
7214588 |
ggctgcgtacaatacacaaaaaatggtgagatcccttctcggacactgcgtatgcgagagttttagtgcaccaggttgcc |
7214667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 86; E-Value: 7e-41
Query Start/End: Original strand, 138 - 317
Target Start/End: Complemental strand, 26684803 - 26684620
Alignment:
| Q |
138 |
gaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacag-cctcttgtgtaaaacag---ggt |
233 |
Q |
| |
|
|||||||||| || |||| |||||||||||||||||||||||| | |||||||| |||| ||||||||||||||| |||||||||||||| | ||| |
|
|
| T |
26684803 |
gaggggtaactttagcgcaactggtaaagttgttgtcatgtgattgaaaggtcaaaggtttaagtcctgaaaacagacctcttgtgtaaaaaaatatggt |
26684704 |
T |
 |
| Q |
234 |
aaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|||||||||||||||| || ||||||||||||| ||||||| ||||||| |||||||||||| || |||||||| ||| ||||| |
|
|
| T |
26684703 |
aaggctgcgtacaatatactaaatggtgggacctcttcccgaaccctgcgtatgcgggagctttaatgcaccggattgtccttt |
26684620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 85; E-Value: 3e-40
Query Start/End: Original strand, 161 - 301
Target Start/End: Complemental strand, 99421 - 99281
Alignment:
| Q |
161 |
gtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggt |
260 |
Q |
| |
|
||||||||||||||| |||||| |||||||||||||||||||||| |||||||||||||| |||||| || ||||||||||||||||||||||||||| |
|
|
| T |
99421 |
gtaaagttgttgtcacgtgactgaaaggtcacgggttcaagtcctagaaacagcctcttgtaaaaaacatggcaaggctgcgtacaatacaccaaatggt |
99322 |
T |
 |
| Q |
261 |
gggaccccttcccggaccctgcatatgcgggagctctagtg |
301 |
Q |
| |
|
|| |||||||| | ||||||| |||||||||||| ||||| |
|
|
| T |
99321 |
ggaaccccttctcagaccctgtgtatgcgggagctttagtg |
99281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 84; E-Value: 1e-39
Query Start/End: Original strand, 139 - 318
Target Start/End: Original strand, 14544018 - 14544202
Alignment:
| Q |
139 |
aggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt---aaaacagggtaa |
235 |
Q |
| |
|
||||||||||||||||| | |||||||||||||||||||||||| |||||| || ||| || || ||| |||||||||||||||| |||||||||||| |
|
|
| T |
14544018 |
aggggtaaccttggcgcaattggtaaagttgttgtcatgtgactgaaaggttacaggtccaggtactggaaacagcctcttgtgtagaaaaacagggtaa |
14544117 |
T |
 |
| Q |
236 |
ggctgcgtacaata--caccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttta |
318 |
Q |
| |
|
| |||||| ||||| || ||||||| ||||||||||| ||||||||| |||||||||||| ||||||||| ||||||||||| |
|
|
| T |
14544118 |
gactgcgtgcaataaccaaaaaatggtcggaccccttccgggaccctgcgtatgcgggagctttagtgcaccaagttgcccttta |
14544202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 83; E-Value: 5e-39
Query Start/End: Original strand, 148 - 313
Target Start/End: Complemental strand, 24860157 - 24859992
Alignment:
| Q |
148 |
cttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa-cagggtaaggctgcgtaca |
246 |
Q |
| |
|
|||||||| ||||||||| |||||||||||||||| ||||| ||||||| ||| |||| ||||| ||||| |||||||| || |||| ||||||||||| |
|
|
| T |
24860157 |
cttggcgcaactggtaaaattgttgtcatgtgactggaaggttacgggtttaagccctggaaacaacctctggtgtaaaaacatggta-ggctgcgtaca |
24860059 |
T |
 |
| Q |
247 |
atacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcc |
313 |
Q |
| |
|
|||||||||||||| | |||||||| |||||||||| |||||||||||| ||||||||||| ||||| |
|
|
| T |
24860058 |
atacaccaaatggtagaaccccttctcggaccctgcgtatgcgggagctttagtgcaccggattgcc |
24859992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 82; E-Value: 2e-38
Query Start/End: Original strand, 169 - 317
Target Start/End: Original strand, 25641487 - 25641636
Alignment:
| Q |
169 |
gttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt-aaaacagggtaaggctgcgtacaatacaccaaatggtgggaccc |
267 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| ||||||| | |||||| |||||||||||| | ||||||||||||||||||| ||||||||| |
|
|
| T |
25641487 |
gttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcattttgtgtgaaaacagggtaaagttgcgtacaatacaccaaattgtgggaccc |
25641586 |
T |
 |
| Q |
268 |
cttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
||||||| | ||||| |||||| ||||| ||||| ||||| ||| ||||| |
|
|
| T |
25641587 |
cttcccgaatcctgcgtatgcgagagctttagtgaaccggattgtccttt |
25641636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 81; E-Value: 7e-38
Query Start/End: Original strand, 160 - 317
Target Start/End: Complemental strand, 21377232 - 21377074
Alignment:
| Q |
160 |
ggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaat |
257 |
Q |
| |
|
||||||||||||||||||||||| |||||| ||| ||||||||| | ||||| |||||||||||||| ||||||||||||| ||||||| |||||||| |
|
|
| T |
21377232 |
ggtaaagttgttgtcatgtgactgaaaggttacgagttcaagtcatagaaacatcctcttgtgtaaaaaacagggtaaggctgggtacaatgcaccaaat |
21377133 |
T |
 |
| Q |
258 |
ggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
||||||||||||||||| ||||||| |||| ||||||| | |||||||| | |||||||| |
|
|
| T |
21377132 |
ggtgggaccccttcccgaaccctgcgtatgtgggagct-ttgtgcaccgagctgcccttt |
21377074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 80; E-Value: 3e-37
Query Start/End: Original strand, 162 - 280
Target Start/End: Original strand, 5450263 - 5450384
Alignment:
| Q |
162 |
taaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt---aaaacagggtaaggctgcgtacaatacaccaaatg |
258 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||| ||||| ||||| |||||||||| |||||| |||||||||||||||||||||||||| | |
|
|
| T |
5450263 |
taaagttgttgtcatgtgactgaaaggtcacgggttcaattcctggaaacaacctcttgtgtaaaaaaacatggtaaggctgcgtacaatacaccaaagg |
5450362 |
T |
 |
| Q |
259 |
gtgggaccccttcccggaccct |
280 |
Q |
| |
|
|||||||||||||| ||||||| |
|
|
| T |
5450363 |
gtgggaccccttcctggaccct |
5450384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 80; E-Value: 3e-37
Query Start/End: Original strand, 138 - 254
Target Start/End: Original strand, 17705449 - 17705567
Alignment:
| Q |
138 |
gaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaa--aacagggtaa |
235 |
Q |
| |
|
||||||||||||||| || ||||||||||||||||||||||||||| |||||||||||||||||||||| |||| ||||||||||||| ||||| |||| |
|
|
| T |
17705449 |
gaggggtaaccttggtgcaactggtaaagttgttgtcatgtgactagaaggtcacgggttcaagtcctggaaaccgcctcttgtgtaaacaacagagtaa |
17705548 |
T |
 |
| Q |
236 |
ggctgcgtacaatacacca |
254 |
Q |
| |
|
||||| ||||||||||||| |
|
|
| T |
17705549 |
ggctgtgtacaatacacca |
17705567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 79; E-Value: 1e-36
Query Start/End: Original strand, 147 - 314
Target Start/End: Complemental strand, 4516522 - 4516354
Alignment:
| Q |
147 |
ccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgta |
244 |
Q |
| |
|
||||||||| || |||||||||||||||| |||||| ||||||||| ||||||| || |||||||||||||||||||| ||||| || |||||||| |
|
|
| T |
4516522 |
ccttggcgcaac-ggtaaagttgttgtcacgtgactgaaaggtcacatattcaagttctagaaacagcctcttgtgtaaaaaacagggcaacgctgcgta |
4516424 |
T |
 |
| Q |
245 |
caatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccc |
314 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||| |||| || |||| ||||| |||||| ||||| |
|
|
| T |
4516423 |
caatacaccaattggtgggaccccttcccggaccctgcgtatgtggaagctttagtgtaccgggctgccc |
4516354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 76; E-Value: 7e-35
Query Start/End: Original strand, 164 - 318
Target Start/End: Complemental strand, 17380391 - 17380237
Alignment:
| Q |
164 |
aagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgta-aaacagggtaaggctgcgtacaatacaccaaatggtgg |
262 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||| || ||||| ||||||||||| ||||||||||||| || || |||||||||||||| ||| |
|
|
| T |
17380391 |
aagttgttgtcatgtgaccgaaaggtcacgggttcaagtcttggaaacaacctcttgtgtataaacagggtaaggttgtgtgcaatacaccaaatgatgg |
17380292 |
T |
 |
| Q |
263 |
gaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttta |
318 |
Q |
| |
|
||||||||| ||||||||| ||||||||||| | |||||||||| | ||||||| |
|
|
| T |
17380291 |
aaccccttcctggaccctgcggatgcgggagct-ttgtgcaccgggcttcccttta |
17380237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 76; E-Value: 7e-35
Query Start/End: Original strand, 139 - 295
Target Start/End: Complemental strand, 32781467 - 32781310
Alignment:
| Q |
139 |
aggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaag |
236 |
Q |
| |
|
||||| ||||||||||| | |||||||||||||| |||| || |||||||||| ||||||||| | ||||| |||||||||||||| ||||||||| |
|
|
| T |
32781467 |
agggggaaccttggcgcaa-tggtaaagttgttgcaatgttgctgaaaggtcacgagttcaagtctcggaaacaacctcttgtgtaaaaaacagggtaag |
32781369 |
T |
 |
| Q |
237 |
gctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagct |
295 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
32781368 |
actgcgtacaatacaccaaatggtgggaccccttcccagaccctgtgtatgcgggagct |
32781310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 76; E-Value: 7e-35
Query Start/End: Original strand, 159 - 317
Target Start/End: Original strand, 44643497 - 44643658
Alignment:
| Q |
159 |
tggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa---cagggtaaggctgcgtacaatacaccaa |
255 |
Q |
| |
|
|||||||||||| |||||||||| |||||||||| |||||||| || ||| |||||||| |||||| ||| ||||||||||||||||| ||||| |
|
|
| T |
44643497 |
tggtaaagttgtcatcatgtgactgaaaggtcacgtgttcaagttctagaaagagcctcttccgtaaaaaaacagagtaaggctgcgtacaatgtaccaa |
44643596 |
T |
 |
| Q |
256 |
atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|||||||||||||||||| |||||||| ||||||||||| |||||||||||| |||||||| |
|
|
| T |
44643597 |
atggtgggaccccttcccagaccctgcgtatgcgggagccttagtgcaccgggctgcccttt |
44643658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 75; E-Value: 3e-34
Query Start/End: Original strand, 160 - 279
Target Start/End: Complemental strand, 23145857 - 23145736
Alignment:
| Q |
160 |
ggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaat |
257 |
Q |
| |
|
|||||||||||||| |||||| |||||||||||||||||||| ||||||||| ||||||||||||| ||| |||||||||||||||||||||||| | |
|
|
| T |
23145857 |
ggtaaagttgttgtagcgtgactgaaaggtcacgggttcaagtcttgaaaacagactcttgtgtaaaaaacagtgtaaggctgcgtacaatacaccaatt |
23145758 |
T |
 |
| Q |
258 |
ggtgggaccccttcccggaccc |
279 |
Q |
| |
|
|||||||||| ||||||||||| |
|
|
| T |
23145757 |
ggtgggaccctttcccggaccc |
23145736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 75; E-Value: 3e-34
Query Start/End: Original strand, 160 - 279
Target Start/End: Complemental strand, 23557647 - 23557526
Alignment:
| Q |
160 |
ggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaat |
257 |
Q |
| |
|
|||||||||||||| |||||| |||||||||||||||||||| ||||||||| ||||||||||||| ||| |||||||||||||||||||||||| | |
|
|
| T |
23557647 |
ggtaaagttgttgtagcgtgactgaaaggtcacgggttcaagtcttgaaaacagactcttgtgtaaaaaacagtgtaaggctgcgtacaatacaccaatt |
23557548 |
T |
 |
| Q |
258 |
ggtgggaccccttcccggaccc |
279 |
Q |
| |
|
|||||||||| ||||||||||| |
|
|
| T |
23557547 |
ggtgggaccctttcccggaccc |
23557526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 73; E-Value: 4e-33
Query Start/End: Original strand, 208 - 317
Target Start/End: Complemental strand, 40762345 - 40762234
Alignment:
| Q |
208 |
aaacagcctcttgtgtaaaaca--gggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcacc |
305 |
Q |
| |
|
|||||||||||||||||||| | |||||||||| ||||||||||||||||||||||||||| |||| ||||||||| |||| ||||||| ||||||||| |
|
|
| T |
40762345 |
aaacagcctcttgtgtaaaaaactgggtaaggctacgtacaatacaccaaatggtgggaccctttcctggaccctgcgtatgtgggagctttagtgcacc |
40762246 |
T |
 |
| Q |
306 |
gggttgcccttt |
317 |
Q |
| |
|
|||||||||||| |
|
|
| T |
40762245 |
gggttgcccttt |
40762234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 70; E-Value: 3e-31
Query Start/End: Original strand, 162 - 305
Target Start/End: Complemental strand, 31158598 - 31158451
Alignment:
| Q |
162 |
taaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaaggctgcgtacaatacacc--aaat |
257 |
Q |
| |
|
||||||||||||||||||||| |||||||| ||||| ||||| | |||||||||||||| || ||||||||||||| ||| ||||||| ||| |||| |
|
|
| T |
31158598 |
taaagttgttgtcatgtgactgaaaggtcaagggttaaagtcttcaaaacagcctcttgcgtaaaaaacagggtaagattgcatacaataaaccaaaaat |
31158499 |
T |
 |
| Q |
258 |
ggtgggaccccttcccggaccctgcatatgcgggagctctagtgcacc |
305 |
Q |
| |
|
|||||||||||||||| |||||||| |||||||||||| |||| |||| |
|
|
| T |
31158498 |
ggtgggaccccttcccagaccctgcgtatgcgggagctttagtacacc |
31158451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 160 - 295
Target Start/End: Original strand, 33795261 - 33795398
Alignment:
| Q |
160 |
ggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaaggctgcgtac-aatacaccaaa |
256 |
Q |
| |
|
|||||||||||||||| |||| | ||||||||||||||||||||| | ||||| ||||||| || |||||||||||||||||||||| |||||||| | |
|
|
| T |
33795261 |
ggtaaagttgttgtcacgtgattgaaaggtcacgggttcaagtcccggaaacaacctcttgggtaaaaaacagggtaaggctgcgtacaaatacacc-ta |
33795359 |
T |
 |
| Q |
257 |
tggtgggaccccttcccggaccctgcatatgcgggagct |
295 |
Q |
| |
|
||||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
33795360 |
tggtgggaccccttcccagaccctgtgtatgcgggagct |
33795398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 185 - 321
Target Start/End: Complemental strand, 13245220 - 13245091
Alignment:
| Q |
185 |
aaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcat |
284 |
Q |
| |
|
||||||||| |||||||||||| ||||| |||||||||| |||||||||||||||| ||||| ||||||||||||||||||||||||| ||||| |
|
|
| T |
13245220 |
aaggtcacgagttcaagtcctggaaacaacctcttgtgt-------ggtaaggctgcgtacattacactaaatggtgggaccccttcccggaccatgcat |
13245128 |
T |
 |
| Q |
285 |
atgcgggagctctagtgcaccgggttgccctttaatg |
321 |
Q |
| |
|
|| |||||||| ||||| | |||||||||||| |||| |
|
|
| T |
13245127 |
atacgggagctttagtgtatcgggttgcccttgaatg |
13245091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 224 - 317
Target Start/End: Original strand, 25632551 - 25632644
Alignment:
| Q |
224 |
aaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||| |||||||| ||| | | |||||||||||| ||||||||||||||||||||| |
|
|
| T |
25632551 |
aaaacaggataaggctgcgtacaatacaccaaatggtgggattccttcccgaaccttacgtatgcgggagctttagtgcaccgggttgcccttt |
25632644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 199 - 305
Target Start/End: Original strand, 30826052 - 30826158
Alignment:
| Q |
199 |
aagtcctgaaaacagcctcttgtgtaaaac-agggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctct |
297 |
Q |
| |
|
||||| || |||||||||||||||||||| ||||||||| |||||||||||||||||||||| ||| |||||||| |||||| |||||||||||||| | |
|
|
| T |
30826052 |
aagtcttggaaacagcctcttgtgtaaaaatagggtaaggttgcgtacaatacaccaaatggt-ggaacccttcccagaccctacatatgcgggagcttt |
30826150 |
T |
 |
| Q |
298 |
agtgcacc |
305 |
Q |
| |
|
|||||||| |
|
|
| T |
30826151 |
agtgcacc |
30826158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 173 - 305
Target Start/End: Original strand, 19614981 - 19615116
Alignment:
| Q |
173 |
tcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaaggctgcgtacaatacacca--aatggtgggacccc |
268 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| ||||| |||||||| | ||||||||||||| |||||||||||| |||| ||| || ||||||| |
|
|
| T |
19614981 |
tcatgtgactgaaaggtcacgggttcaagtccttgaaacatcctcttgtataaaaaacagggtaagactgcgtacaatataccaataatagt-ggacccc |
19615079 |
T |
 |
| Q |
269 |
ttcccggaccctgcatatgcgggagctctagtgcacc |
305 |
Q |
| |
|
|||||| ||||||| ||||| |||||| ||||||||| |
|
|
| T |
19615080 |
ttcccgaaccctgcgtatgcaggagctttagtgcacc |
19615116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 224 - 304
Target Start/End: Original strand, 24890453 - 24890533
Alignment:
| Q |
224 |
aaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcac |
304 |
Q |
| |
|
|||||| ||||||||||| ||||||||||||| |||||||||||||||||||||||||| ||||| |||||| |||||||| |
|
|
| T |
24890453 |
aaaacaaggtaaggctgcatacaatacaccaattggtgggaccccttcccggaccctgcgtatgcaggagctttagtgcac |
24890533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 160 - 295
Target Start/End: Complemental strand, 44521532 - 44521395
Alignment:
| Q |
160 |
ggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaat |
257 |
Q |
| |
|
|||||||||||| ||| |||||| |||||||||| |||||| || || ||||| ||||||||||||| || ||||||||||| || |||||||||||| |
|
|
| T |
44521532 |
ggtaaagttgttatcacgtgactgaaaggtcacgcgttcaaatcttggaaacaatctcttgtgtaaaaaacaaggtaaggctgcatataatacaccaaat |
44521433 |
T |
 |
| Q |
258 |
ggtgggaccccttcccggaccctgcatatgcgggagct |
295 |
Q |
| |
|
|| |||| |||||||| ||| ||||||| |||||||| |
|
|
| T |
44521432 |
ggcgggagcccttcccagacattgcatatacgggagct |
44521395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 161 - 314
Target Start/End: Complemental strand, 45235976 - 45235820
Alignment:
| Q |
161 |
gtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaa---aacagggtaaggctgcgtacaatacaccaaat |
257 |
Q |
| |
|
||||||||||| |||||||||| |||| ||||| ||||||||||| |||||| ||||| ||||| || ||||||||||| ||| ||||||| |||| |
|
|
| T |
45235976 |
gtaaagttgttctcatgtgactgaaagatcacgagttcaagtcctagaaacagtctcttctgtaaaataatagggtaaggctacgtgtaatacacaaaat |
45235877 |
T |
 |
| Q |
258 |
ggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccc |
314 |
Q |
| |
|
||||||||||||| || |||||| | ||||| |||||| ||||| ||| ||||||| |
|
|
| T |
45235876 |
ggtgggaccccttaccagaccctacgtatgcaggagctttagtgtaccaagttgccc |
45235820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 54; E-Value: 9e-22
Query Start/End: Original strand, 173 - 282
Target Start/End: Complemental strand, 44449529 - 44449418
Alignment:
| Q |
173 |
tcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttg--tgtaaaacagggtaaggctgcgtacaatacacc-aaatggtgggacccct |
269 |
Q |
| |
|
|||||| ||| |||||||||| |||||| |||| |||||| ||||||| || |||||||| ||||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
44449529 |
tcatgtaactgaaaggtcacgagttcaa-tcctaaaaacaacctcttgaatgaaaaacaggataaggctgcgtacaatacaccaaaatagtgggacccct |
44449431 |
T |
 |
| Q |
270 |
tcccggaccctgc |
282 |
Q |
| |
|
||||||||||||| |
|
|
| T |
44449430 |
tcccggaccctgc |
44449418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 257 - 317
Target Start/End: Original strand, 34080176 - 34080236
Alignment:
| Q |
257 |
tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
34080176 |
tggtgggaccccttcccggaccctgcatatgcgggagttttagtgcaccgggttgcccttt |
34080236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 256 - 315
Target Start/End: Original strand, 41409936 - 41409995
Alignment:
| Q |
256 |
atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccct |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
41409936 |
atggtgggaccccttcccggaccctgcatatgcgggagcttcagtgcaccgggttgccct |
41409995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #52
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 160 - 256
Target Start/End: Complemental strand, 29420048 - 29419946
Alignment:
| Q |
160 |
ggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagg----gtaaggctgcgtacaatacacc |
253 |
Q |
| |
|
|||||||||||||||| ||||| |||||||||| |||||||||||| ||||| |||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
29420048 |
ggtaaagttgttgtcacatgactgaaaggtcacgagttcaagtcctggaaacaacctcttgtgtaaaaaacagggtaagtaaggctgcgtacaatacacc |
29419949 |
T |
 |
| Q |
254 |
aaa |
256 |
Q |
| |
|
||| |
|
|
| T |
29419948 |
aaa |
29419946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #53
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 193 - 317
Target Start/End: Complemental strand, 15296533 - 15296406
Alignment:
| Q |
193 |
gggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacacc-aaatggtgggaccccttcccggaccctgcatatgcg |
289 |
Q |
| |
|
|||||||||||| | ||||||||| |||||||||| |||||||||||||||||||||| ||| |||| |||||| |||||| |||||||||| |||| | |
|
|
| T |
15296533 |
gggttcaagtcccggaaacagcctgttgtgtaaaatacagggtaaggctgcgtacaatataccaaaatagtgggatcccttctcggaccctgcgtatgtg |
15296434 |
T |
 |
| Q |
290 |
ggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
| |||| | |||| || || |||||||| |
|
|
| T |
15296433 |
gaagctttggtgcgccaggctgcccttt |
15296406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #54
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 169 - 305
Target Start/End: Complemental strand, 31821491 - 31821355
Alignment:
| Q |
169 |
gttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggacccc |
268 |
Q |
| |
|
||||| |||||||| |||||||||| ||||||||| | |||||||| ||| |||| ||||||||| || ||||||||||||||||| ||||||||| |
|
|
| T |
31821491 |
gttgttatgtgactgaaaggtcacgagttcaagtcgtagaaacagccgtgtgtaaaaaatagggtaaggttgtgtacaatacaccaaatgatgggacccc |
31821392 |
T |
 |
| Q |
269 |
ttcccggaccctgcatatgcgggagctctagtgcacc |
305 |
Q |
| |
|
|| ||| | |||| |||||||||||| || |||||| |
|
|
| T |
31821391 |
tttccgaaacctgtgtatgcgggagctttaatgcacc |
31821355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #55
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 256 - 316
Target Start/End: Complemental strand, 40579810 - 40579750
Alignment:
| Q |
256 |
atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctt |
316 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||| |
|
|
| T |
40579810 |
atggtgggaccccttcccggaccctgagtatgcgggagctttagtgcaccgggttgccctt |
40579750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #56
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 157 - 236
Target Start/End: Original strand, 44604827 - 44604907
Alignment:
| Q |
157 |
actggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt-aaaacagggtaag |
236 |
Q |
| |
|
|||| ||||||||||||||||||||| |||||||| ||||||||||||| ||||| |||||||||| ||||||||||||| |
|
|
| T |
44604827 |
actgctaaagttgttgtcatgtgactggaaggtcacaggttcaagtcctggaaacaacctcttgtgtaaaaacagggtaag |
44604907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #57
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 254 - 317
Target Start/End: Original strand, 23488555 - 23488618
Alignment:
| Q |
254 |
aaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| ||||| |||||||||||||||| |||| |
|
|
| T |
23488555 |
aaatggtgggaccccttcccggaccctgcgtatgcgagagctttagtgcaccgggttgctcttt |
23488618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #58
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 251 - 304
Target Start/End: Original strand, 4794871 - 4794924
Alignment:
| Q |
251 |
accaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcac |
304 |
Q |
| |
|
|||||||| ||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
4794871 |
accaaatgatgggaccccttcccggatcctgcatatgcgggagctctagtgcac |
4794924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #59
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 208 - 307
Target Start/End: Original strand, 17471572 - 17471675
Alignment:
| Q |
208 |
aaacagcctcttgtgtaaaa---cagggtaaggctgcgtacaatacaccaaa-tggtgggaccccttcccggaccctgcatatgcgggagctctagtgca |
303 |
Q |
| |
|
|||||||||||||||||||| |||| |||| |||||||||||| |||||| || || ||||||||||| |||||||| |||||||||| | ||||||| |
|
|
| T |
17471572 |
aaacagcctcttgtgtaaaaaaacaggataagactgcgtacaatataccaaaatgatgagaccccttccctgaccctgcctatgcgggagttttagtgca |
17471671 |
T |
 |
| Q |
304 |
ccgg |
307 |
Q |
| |
|
|||| |
|
|
| T |
17471672 |
ccgg |
17471675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #60
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 178 - 261
Target Start/End: Complemental strand, 2003678 - 2003592
Alignment:
| Q |
178 |
tgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa---cagggtaaggctgcgtacaatacaccaaatggtg |
261 |
Q |
| |
|
||||| ||||||||||||| ||||||||| |||||||| |||| |||||| |||||||||| ||||||||||||| ||||||||| |
|
|
| T |
2003678 |
tgactgaaaggtcacgggtacaagtcctggaaacagccccttgcgtaaaaaaacagggtaaggatgcgtacaatacaacaaatggtg |
2003592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #61
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 262 - 322
Target Start/End: Original strand, 8575975 - 8576035
Alignment:
| Q |
262 |
ggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttaatgt |
322 |
Q |
| |
|
||||||||||||||||||||| |||| ||||||| ||||||||| |||||||||||||||| |
|
|
| T |
8575975 |
ggaccccttcccggaccctgcgtatgtgggagctttagtgcaccaggttgccctttaatgt |
8576035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #62
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 257 - 317
Target Start/End: Original strand, 34766330 - 34766390
Alignment:
| Q |
257 |
tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||| ||||||| |||||| |||||| |
|
|
| T |
34766330 |
tggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaacgggtttcccttt |
34766390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #63
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 266 - 313
Target Start/End: Complemental strand, 39189555 - 39189508
Alignment:
| Q |
266 |
cccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcc |
313 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
39189555 |
cccttcccggaccccgcatatgcgggagctctagtgcaccgggttgcc |
39189508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #64
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 263 - 317
Target Start/End: Complemental strand, 3633762 - 3633708
Alignment:
| Q |
263 |
gaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||| |||||||||| |
|
|
| T |
3633762 |
gaccccttcccggaccccgcatatgcgggagctttagtgcaccgagttgcccttt |
3633708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #65
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 161 - 317
Target Start/End: Original strand, 4795730 - 4795890
Alignment:
| Q |
161 |
gtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa---cagggtaaggctgcgtacaatacaccaaa- |
256 |
Q |
| |
|
||||||||||||||| |||||| ||| ||||| ||| ||||| ||||||||||||| || |||||| || | | || |||||| |||||||||||| |
|
|
| T |
4795730 |
gtaaagttgttgtcacgtgactgaaaagtcacttgttgaagtcttgaaaacagcctcatgcgtaaaaaaacaagattagactgcgtgcaatacaccaaaa |
4795829 |
T |
 |
| Q |
257 |
tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|||||||||| |||||||||| || ||||| | |||| ||||||| |||||||||||| |
|
|
| T |
4795830 |
tggtgggaccttttcccggaccttgtgtatgccgaagctttagtgcagtgggttgcccttt |
4795890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #66
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 147 - 215
Target Start/End: Original strand, 35017781 - 35017849
Alignment:
| Q |
147 |
ccttggcgccactggtaaagttgttgtcatgtgacta-aaaggtcacgggttcaagtcctgaaaacagcc |
215 |
Q |
| |
|
||||||||| || ||||||||||||||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
35017781 |
ccttggcgcaac-ggtaaagttgttgtcatgtgacttgaaaggtcacgggtttaagtcctgaaaacagcc |
35017849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #67
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 137 - 182
Target Start/End: Complemental strand, 39189603 - 39189558
Alignment:
| Q |
137 |
tgaggggtaaccttggcgccactggtaaagttgttgtcatgtgact |
182 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
39189603 |
tgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgact |
39189558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #68
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 224 - 305
Target Start/End: Complemental strand, 39499323 - 39499242
Alignment:
| Q |
224 |
aaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcacc |
305 |
Q |
| |
|
|||| ||||||| ||||||||||||||| |||||||||||| ||||| || | ||||| |||||||||||| ||||||||| |
|
|
| T |
39499323 |
aaaatagggtaaagctgcgtacaatacatcaaatggtgggatcccttttcgaatcctgcgtatgcgggagctttagtgcacc |
39499242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #69
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 269 - 317
Target Start/End: Original strand, 22371199 - 22371247
Alignment:
| Q |
269 |
ttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|||||||||||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
22371199 |
ttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
22371247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #70
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 255 - 317
Target Start/End: Original strand, 1289095 - 1289158
Alignment:
| Q |
255 |
aatggtgggaccccttcccggaccctgcatatgcgggagc-tctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|||||||||||||||||||||| | ||||||||||||||| | ||||||||||| ||||||||| |
|
|
| T |
1289095 |
aatggtgggaccccttcccggatcatgcatatgcgggagcttttagtgcaccggattgcccttt |
1289158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #71
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 247 - 314
Target Start/End: Original strand, 31525771 - 31525838
Alignment:
| Q |
247 |
atacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccc |
314 |
Q |
| |
|
|||||||||||| |||||||| || || ||||||||||||||||||||| ||||| ||||| |||||| |
|
|
| T |
31525771 |
atacaccaaatgatgggaccctttgccagaccctgcatatgcgggagctttagtgtaccggattgccc |
31525838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #72
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 247 - 309
Target Start/End: Original strand, 31523296 - 31523358
Alignment:
| Q |
247 |
atacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggt |
309 |
Q |
| |
|
|||||||||||||||| |||| ||||| |||||||||||||||||||| |||||||| |||| |
|
|
| T |
31523296 |
atacaccaaatggtggaaccctttcccaaaccctgcatatgcgggagctttagtgcactgggt |
31523358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #73
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 199 - 295
Target Start/End: Complemental strand, 30864536 - 30864439
Alignment:
| Q |
199 |
aagtcctgaaaacagcctcttgtgtaaaac-agggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagct |
295 |
Q |
| |
|
||||| || |||||||||||||||||||| ||||||||| ||||||||||| |||||||||| || || ||||| ||||||| ||||||| |||| |
|
|
| T |
30864536 |
aagtcatggaaacagcctcttgtgtaaaaatagggtaagggtgcgtacaatataccaaatggtaagatcctttcccaaaccctgcgtatgcggaagct |
30864439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #74
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 269 - 313
Target Start/End: Complemental strand, 124962 - 124918
Alignment:
| Q |
269 |
ttcccggaccctgcatatgcgggagctctagtgcaccgggttgcc |
313 |
Q |
| |
|
|||||||||||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
124962 |
ttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcc |
124918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #75
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 246 - 301
Target Start/End: Complemental strand, 24059067 - 24059012
Alignment:
| Q |
246 |
aatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtg |
301 |
Q |
| |
|
||||||||| ||||||||||||||| ||||||||||| |||| ||||||| ||||| |
|
|
| T |
24059067 |
aatacaccatatggtgggacccctttccggaccctgcgtatgtgggagctttagtg |
24059012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #76
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 184 - 272
Target Start/End: Complemental strand, 12315786 - 12315697
Alignment:
| Q |
184 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa-cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcc |
272 |
Q |
| |
|
|||||||||| ||||||||| || ||||||| |||| | |||| ||||||||| ||| |||||||||||||||| ||| ||| |||||| |
|
|
| T |
12315786 |
aaaggtcacgagttcaagtcatggaaacagcttcttattaaaaaacagggtaagactgtgtacaatacaccaaatagtgagactccttcc |
12315697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #77
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 138 - 187
Target Start/End: Complemental strand, 27466311 - 27466262
Alignment:
| Q |
138 |
gaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaag |
187 |
Q |
| |
|
|||| ||||| ||||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
27466311 |
gaggcgtaacattggcgcaactggtaaagttgttgtcatgtgactgaaag |
27466262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #78
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 139 - 227
Target Start/End: Original strand, 17472926 - 17473014
Alignment:
| Q |
139 |
aggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa |
227 |
Q |
| |
|
||||||||||||| ||| ||| |||||||||||||| ||| | |||||||||||||||| ||| | ||| ||||| |||||||||| |
|
|
| T |
17472926 |
aggggtaaccttgacgcaactaataaagttgttgtcaaatgattgaaaggtcacgggttcaggtcttagaaatagcctattgtgtaaaa |
17473014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #79
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 254 - 318
Target Start/End: Complemental strand, 19185806 - 19185742
Alignment:
| Q |
254 |
aaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttta |
318 |
Q |
| |
|
||||||||| ||||||||| ||||||||| |||||||||||| |||| || || ||| ||||||| |
|
|
| T |
19185806 |
aaatggtggaaccccttcctggaccctgcgtatgcgggagctttagtacatcgagttacccttta |
19185742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #80
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 142 - 227
Target Start/End: Complemental strand, 4852388 - 4852306
Alignment:
| Q |
142 |
ggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa |
227 |
Q |
| |
|
||||||||||| || ||||| |||||||| |||||||| ||| |||| |||||||||||||| |||||| |||||||| |||| |
|
|
| T |
4852388 |
ggtaaccttggtgcaactggcaaagttgt---catgtgaccgaaaagtcaggggttcaagtcctgcaaacagtctcttgtgaaaaa |
4852306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #81
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 248 - 276
Target Start/End: Original strand, 4252656 - 4252684
Alignment:
| Q |
248 |
tacaccaaatggtgggaccccttcccgga |
276 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
4252656 |
tacaccaaatggtgggaccccttcccgga |
4252684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 148; Significance: 7e-78; HSPs: 80)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 148; E-Value: 7e-78
Query Start/End: Original strand, 138 - 317
Target Start/End: Original strand, 35710267 - 35710446
Alignment:
| Q |
138 |
gaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaagg |
237 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||| ||| ||||||||||||||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
35710267 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtaactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaatagggtaagg |
35710366 |
T |
 |
| Q |
238 |
ctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35710367 |
ctgcgttcaatacaccaaatggtgggaccccttcccggaacatgcatatgcgggagctctagtgcaccgggttgcccttt |
35710446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 146; E-Value: 1e-76
Query Start/End: Original strand, 137 - 317
Target Start/End: Original strand, 41014272 - 41014453
Alignment:
| Q |
137 |
tgaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa-cagggtaa |
235 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
41014272 |
tgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaacagggtaa |
41014371 |
T |
 |
| Q |
236 |
ggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
41014372 |
ggctgcgtacaatacaccaaatggtgggaccccttcctggaccccgcatatgcgggagctttagtgcaccgggttgcccttt |
41014453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 144; E-Value: 2e-75
Query Start/End: Original strand, 138 - 317
Target Start/End: Complemental strand, 8170163 - 8169984
Alignment:
| Q |
138 |
gaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaagg |
237 |
Q |
| |
|
||||| |||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
8170163 |
gagggctaaccttggcgcaactggtaaagttgttgtcatgtgaccgaaaggtcacgggttcaagtcctggaaacagccttttgtgtaaaacagggtaagg |
8170064 |
T |
 |
| Q |
238 |
ctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
8170063 |
ctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagtttcagtgcaccgggttgcccttt |
8169984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 139; E-Value: 2e-72
Query Start/End: Original strand, 171 - 317
Target Start/End: Original strand, 32703411 - 32703557
Alignment:
| Q |
171 |
tgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggacccctt |
270 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32703411 |
tgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggacccctt |
32703510 |
T |
 |
| Q |
271 |
cccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32703511 |
cccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
32703557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 139; E-Value: 2e-72
Query Start/End: Original strand, 137 - 317
Target Start/End: Original strand, 38879534 - 38879718
Alignment:
| Q |
137 |
tgaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||| | ||||||||||| |
|
|
| T |
38879534 |
tgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtataaaaaacagggta |
38879633 |
T |
 |
| Q |
235 |
aggctgcgtacaatacacca--aatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
38879634 |
aggctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
38879718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 135; E-Value: 4e-70
Query Start/End: Original strand, 138 - 317
Target Start/End: Original strand, 24448844 - 24449025
Alignment:
| Q |
138 |
gaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaaca--gggtaa |
235 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||| |||||||||| | |||||| |
|
|
| T |
24448844 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagccttttgtgtaaaaaatagggtaa |
24448943 |
T |
 |
| Q |
236 |
ggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||| ||||||||||||||||||||| |
|
|
| T |
24448944 |
ggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcaggagctttagtgcaccgggttgcccttt |
24449025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 127; E-Value: 3e-65
Query Start/End: Original strand, 141 - 317
Target Start/End: Complemental strand, 4619284 - 4619104
Alignment:
| Q |
141 |
gggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaaggc |
238 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||| ||| |||||||||||| ||||||||||||||| |
|
|
| T |
4619284 |
gggtaaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaatagcctcttgtgtaaaaaacagggtaaggc |
4619185 |
T |
 |
| Q |
239 |
tgcgtacaatacacca--aatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||| ||||||||| ||||| ||||||||||||||||||||| |
|
|
| T |
4619184 |
tgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgagagctttagtgcaccgggttgcccttt |
4619104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 125; E-Value: 4e-64
Query Start/End: Original strand, 141 - 317
Target Start/End: Original strand, 43334159 - 43334339
Alignment:
| Q |
141 |
gggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt---aaaacagggtaagg |
237 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||| ||||| |||||||||||||| |
|
|
| T |
43334159 |
gggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcctgtgtaaaaaaacagggtaagg |
43334258 |
T |
 |
| Q |
238 |
ctgcgtacaatacacc--aaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
43334259 |
ctgcgtacaatacaccaaaaatggtgggaccccttcccggaccctgc-gatgcgggagctttagtgcaccgggttgcccttt |
43334339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 114; E-Value: 1e-57
Query Start/End: Original strand, 138 - 318
Target Start/End: Original strand, 1565385 - 1565567
Alignment:
| Q |
138 |
gaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa---cagggta |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||| ||||||| ||||||||||||||| ||||| ||||||| |||||| || || |
|
|
| T |
1565385 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcgcgggttcaagtcctggaaacaacctcttgagtaaaaaaacatatta |
1565484 |
T |
 |
| Q |
235 |
aggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttta |
318 |
Q |
| |
|
|||||||||||||| |||||||||| ||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
1565485 |
aggctgcgtacaatgcaccaaatggcgggaccccttcccggaccctgcatatgtgggagct-tagtgcaccgggttgcccttta |
1565567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 104; E-Value: 1e-51
Query Start/End: Original strand, 199 - 314
Target Start/End: Original strand, 7368413 - 7368528
Alignment:
| Q |
199 |
aagtcctgaaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctcta |
298 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
7368413 |
aagtcctggaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaattggtgggaccccttcccggaccctgcatatgtgggagctcta |
7368512 |
T |
 |
| Q |
299 |
gtgcaccgggttgccc |
314 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
7368513 |
gtgcaccgggttgccc |
7368528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 104; E-Value: 1e-51
Query Start/End: Original strand, 136 - 313
Target Start/End: Original strand, 27328704 - 27328885
Alignment:
| Q |
136 |
ctgaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggt |
233 |
Q |
| |
|
|||| ||||||||||| ||| | |||||||||||||||||||||||| ||||||||| ||||||||||||| |||||| ||||||||| |||||||||| |
|
|
| T |
27328704 |
ctgaagggtaaccttgacgcaattggtaaagttgttgtcatgtgactgaaaggtcacaggttcaagtcctggaaacagtctcttgtgtaaaaaacagggt |
27328803 |
T |
 |
| Q |
234 |
aaggctgcgtacaatacacca--aatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcc |
313 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||| ||||||| |||||||||||| || |||| ||| ||||| |
|
|
| T |
27328804 |
aaggctgcgtacaatacaccaataatggtgggaccccttcccgaaccctgcgtatgcgggagctttaatgcatcggattgcc |
27328885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 97; E-Value: 2e-47
Query Start/End: Original strand, 141 - 317
Target Start/End: Complemental strand, 22861844 - 22861669
Alignment:
| Q |
141 |
gggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaaggctg |
240 |
Q |
| |
|
||||||||||||| | |||| ||||||||||||||||||||| ||||||||||| |||||||||| || ||| ||||||||||||||| | |||| ||| |
|
|
| T |
22861844 |
gggtaaccttggcacaactgataaagttgttgtcatgtgactgaaaggtcacggattcaagtcctagaagcagtctcttgtgtaaaacaag-taagactg |
22861746 |
T |
 |
| Q |
241 |
cgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
| |||||||| ||||||||||||||||||| || ||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
22861745 |
ctcacaatacatcaaatggtgggaccccttctcgaaccctgcatatgcgggagctctagtgcaccgaattgcccttt |
22861669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 95; E-Value: 3e-46
Query Start/End: Original strand, 137 - 247
Target Start/End: Complemental strand, 37024736 - 37024626
Alignment:
| Q |
137 |
tgaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaag |
236 |
Q |
| |
|
|||||||||||||||| || |||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
37024736 |
tgaggggtaaccttggtgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaacagggtaag |
37024637 |
T |
 |
| Q |
237 |
gctgcgtacaa |
247 |
Q |
| |
|
||||||||||| |
|
|
| T |
37024636 |
gctgcgtacaa |
37024626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 92; E-Value: 2e-44
Query Start/End: Original strand, 159 - 317
Target Start/End: Complemental strand, 19143102 - 19142943
Alignment:
| Q |
159 |
tggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa-cagggtaaggctgcgtacaatacaccaaat |
257 |
Q |
| |
|
||||||| ||||||||| |||||||||| | ||| ||||||||||||| ||||| |||||||||||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
19143102 |
tggtaaaattgttgtcacgtgactaaaatgccacaggttcaagtcctggaaacaacctcttgtgtaaaaacagggtaaggctgcgtacagtacaccaaat |
19143003 |
T |
 |
| Q |
258 |
ggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
||||||||||||||||||||| ||| |||||||||| | |||||||| || |||||||| |
|
|
| T |
19143002 |
ggtgggaccccttcccggaccatgcgtatgcgggagatttagtgcactggcctgcccttt |
19142943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 90; E-Value: 3e-43
Query Start/End: Original strand, 139 - 294
Target Start/End: Original strand, 2838733 - 2838890
Alignment:
| Q |
139 |
aggggtaaccttggcgccactggtaaagttgttgtcatgtgacta-aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa-cagggtaag |
236 |
Q |
| |
|
||||||||||||||||| || ||||||||||||||||||||||| |||||||||| | ||||||| ||||||| |||||||||||| ||||||||| |
|
|
| T |
2838733 |
aggggtaaccttggcgcaaccggtaaagttgttgtcatgtgactgtaaaggtcacgaggtcaagtctcagaaacagcatcttgtgtaaaaacagggtaag |
2838832 |
T |
 |
| Q |
237 |
gctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagc |
294 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||| |||||||||| ||||||||||| |
|
|
| T |
2838833 |
gctgcgtacaatacaccaaatggtgggatcccttctcggaccctgcgtatgcgggagc |
2838890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 88; E-Value: 5e-42
Query Start/End: Original strand, 193 - 318
Target Start/End: Complemental strand, 13801895 - 13801766
Alignment:
| Q |
193 |
gggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgc |
288 |
Q |
| |
|
|||||||||||||| || ||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
13801895 |
gggttcaagtcctggaagcagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgc |
13801796 |
T |
 |
| Q |
289 |
gggagctctagtgcaccgggttgcccttta |
318 |
Q |
| |
|
| ||||| |||||||||||||||||||||| |
|
|
| T |
13801795 |
gagagctttagtgcaccgggttgcccttta |
13801766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 88; E-Value: 5e-42
Query Start/End: Original strand, 223 - 318
Target Start/End: Complemental strand, 34154908 - 34154813
Alignment:
| Q |
223 |
taaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttta |
318 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
34154908 |
taaatcagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcggtagctctagtgcaccgggttgcccttta |
34154813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 86; E-Value: 7e-41
Query Start/End: Original strand, 167 - 317
Target Start/End: Original strand, 1405170 - 1405322
Alignment:
| Q |
167 |
ttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaaca--gggtaaggctgcgtacaatacaccaaatggtggga |
264 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||| ||||| |||||| | ||||| | | ||||| |||||||||||||||||||||||||| |
|
|
| T |
1405170 |
ttgttgtcatgtgactagaaggtcacgggttcaagtcctggaaacaacctcttatataaaaaatagagtaagtttgcgtacaatacaccaaatggtggga |
1405269 |
T |
 |
| Q |
265 |
ccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
||| |||| | ||||||||||||||||||||||||| |||||| ||||||||| |
|
|
| T |
1405270 |
ccctttcctgaaccctgcatatgcgggagctctagtacaccggattgcccttt |
1405322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 86; E-Value: 7e-41
Query Start/End: Original strand, 137 - 295
Target Start/End: Original strand, 22600407 - 22600567
Alignment:
| Q |
137 |
tgaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaaca--gggta |
234 |
Q |
| |
|
||||||||||||||| || ||||||||||||||| |||||||||| ||||| |||||||||||||||| ||||| | |||||||||||| ||||| |
|
|
| T |
22600407 |
tgaggggtaaccttgacgtaactggtaaagttgttatcatgtgactggaaggttacgggttcaagtcctggaaacaatattttgtgtaaaacacagggta |
22600506 |
T |
 |
| Q |
235 |
aggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagct |
295 |
Q |
| |
|
|||||| ||||||||||||||||||||||| ||||||||||| ||||| |||||||||||| |
|
|
| T |
22600507 |
aggctgtgtacaatacaccaaatggtgggatcccttcccggatcctgcgtatgcgggagct |
22600567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 83; E-Value: 5e-39
Query Start/End: Original strand, 160 - 308
Target Start/End: Complemental strand, 209086 - 208936
Alignment:
| Q |
160 |
ggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt-aaaacagggtaaggctgcgtacaatacacc-aaat |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||| |||| |||||||||| |||||||||||||||||| | ||||||||| |||| |
|
|
| T |
209086 |
ggtaaagttgttgtcatgtgactaaaaggtcacaagttcaagtcctggcaacaacctcttgtgtaaaaacagggtaaggctgcattcaatacaccaaaat |
208987 |
T |
 |
| Q |
258 |
ggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccggg |
308 |
Q |
| |
|
||||||||||||||| |||||||| ||||| ||||| |||||||||||| |
|
|
| T |
208986 |
ggtgggaccccttcctggaccctgggtatgcaagagctttagtgcaccggg |
208936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 81; E-Value: 7e-38
Query Start/End: Original strand, 187 - 308
Target Start/End: Original strand, 43574609 - 43574732
Alignment:
| Q |
187 |
ggtcacgggttcaagtcctgaaaacagcctcttgtgta--aaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcat |
284 |
Q |
| |
|
||||||| |||||||||||| ||||| |||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| | |
|
|
| T |
43574609 |
ggtcacgtgttcaagtcctggaaacaatctcttgtgtagaaaacagggtaaggctgcgtacaatataccaaatggtgggaccccttcccggaccctgcgt |
43574708 |
T |
 |
| Q |
285 |
atgcgggagctctagtgcaccggg |
308 |
Q |
| |
|
||||||||||| ||| |||||||| |
|
|
| T |
43574709 |
atgcgggagctttagagcaccggg |
43574732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 79; E-Value: 1e-36
Query Start/End: Original strand, 149 - 316
Target Start/End: Complemental strand, 12006500 - 12006329
Alignment:
| Q |
149 |
ttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacggg-ttcaagtcctgaaaacagcctcttgtgtaaaaca--gggtaaggctgcgtac |
245 |
Q |
| |
|
||||||| |||| | ||||||||||||||||||| |||||||||||| |||||||| || ||||| |||||| ||||||| | |||||||||| | ||| |
|
|
| T |
12006500 |
ttggcgcaactgctcaagttgttgtcatgtgactgaaaggtcacggggttcaagtc-tggaaacaacctcttatgtaaaaaatagggtaaggctccatac |
12006402 |
T |
 |
| Q |
246 |
aatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctt |
316 |
Q |
| |
|
|||||||||| |||||||||||||||||| |||||||| |||||||||||| |||||||||| ||||||||| |
|
|
| T |
12006401 |
aatacaccaataatggtgggaccccttcccagaccctgcctatgcgggagctttagtgcaccgtgttgccctt |
12006329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 78; E-Value: 4e-36
Query Start/End: Original strand, 144 - 318
Target Start/End: Original strand, 30006285 - 30006461
Alignment:
| Q |
144 |
taaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaa--acagggtaaggctgc |
241 |
Q |
| |
|
|||| ||||||| |||| |||| |||||||||||||||| |||||||| | ||||||||| ||||||| |||||| | |||| |||||||||||||| |
|
|
| T |
30006285 |
taacattggcgcaactgataaatttgttgtcatgtgactgaaaggtcatagattcaagtccggaaaacaacctcttatataaacaacagggtaaggctgt |
30006384 |
T |
 |
| Q |
242 |
gtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttta |
318 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||| ||| |||||||||||| ||||||||||||||||| |||| |
|
|
| T |
30006385 |
gtacattacactaaatggtgggaccccttcccggggcctatgtatgcgggagctttagtgcaccgggttgcctttta |
30006461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 77; E-Value: 2e-35
Query Start/End: Original strand, 209 - 318
Target Start/End: Complemental strand, 16880757 - 16880646
Alignment:
| Q |
209 |
aacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccg |
306 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||| ||||||||||| ||| |||||||||||| |||||||||| |
|
|
| T |
16880757 |
aacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaatggtgtgaccacttcccggaccatgcgtatgcgggagctttagtgcaccg |
16880658 |
T |
 |
| Q |
307 |
ggttgcccttta |
318 |
Q |
| |
|
|||| ||||||| |
|
|
| T |
16880657 |
ggtttcccttta |
16880646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 76; E-Value: 7e-35
Query Start/End: Original strand, 137 - 318
Target Start/End: Original strand, 22187238 - 22187423
Alignment:
| Q |
137 |
tgaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggta |
234 |
Q |
| |
|
||||||||||| ||||||| ||| |||||||||||||||| ||||| ||||||||| |||| |||||||| |||||||||||||||| |||||| | || |
|
|
| T |
22187238 |
tgaggggtaactttggcgcaactagtaaagttgttgtcatttgactgaaaggtcaccggtttaagtcctggaaacagcctcttgtgtaaaaaacatgata |
22187337 |
T |
 |
| Q |
235 |
aggctgcgtacaatacacc--aaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttta |
318 |
Q |
| |
|
|| |||||||||||||||| ||| || ||||||||||| ||||| ||||||| |||||| ||||||| | |||||||||||| |
|
|
| T |
22187338 |
agactgcgtacaatacaccaaaaacaatgagaccccttcccaaaccctacatatgcaggagctttagtgcatcaggttgcccttta |
22187423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 74; E-Value: 1e-33
Query Start/End: Original strand, 206 - 318
Target Start/End: Complemental strand, 7097872 - 7097759
Alignment:
| Q |
206 |
gaaaacagcctcttgtgtaaaa-cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcac |
304 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| ||||||||||||||||||||||| |||||||||||| ||||||| |||||||||||| |||||||| |
|
|
| T |
7097872 |
gaaaacagcctcttgtgtaaaaacagggtaaggttgcgtacaatacaccaaatggtgagaccccttcccgaaccctgcgtatgcgggagctttagtgcac |
7097773 |
T |
 |
| Q |
305 |
cgggttgcccttta |
318 |
Q |
| |
|
| | ||||||||| |
|
|
| T |
7097772 |
catgctgcccttta |
7097759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 74; E-Value: 1e-33
Query Start/End: Original strand, 160 - 317
Target Start/End: Complemental strand, 28516593 - 28516433
Alignment:
| Q |
160 |
ggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaaggctgcgtacaataca-ccaaa |
256 |
Q |
| |
|
|||||||||||||||| ||| || |||||||||||||||||||| || ||||| |||||||||| |||||||| || |||||||||||||||| | ||| |
|
|
| T |
28516593 |
ggtaaagttgttgtcaggtggctgaaaggtcacgggttcaagtcttggaaacatcctcttgtgtaaaaaacaggctagggctgcgtacaatacatcaaaa |
28516494 |
T |
 |
| Q |
257 |
tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
||||||||||| ||||| |||||||| |||| |||||| ||||| ||| ||||||||||| |
|
|
| T |
28516493 |
tggtgggacccattcccagaccctgcgcatgcaggagctttagtggaccaggttgcccttt |
28516433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 73; E-Value: 4e-33
Query Start/End: Original strand, 168 - 307
Target Start/End: Original strand, 1850624 - 1850764
Alignment:
| Q |
168 |
tgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa-cagggtaaggctgcgtacaatacaccaaatggtgggacc |
266 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||| | ||| | |||||||||||||| ||| ||||| ||||||||||||| |||||||||||||| |
|
|
| T |
1850624 |
tgttgtcatgtgactgaaaggtcacgggttcaagtcccggaaataacctcttgtgtaaaaacagaataagggtgcgtacaatacatcaaatggtgggacc |
1850723 |
T |
 |
| Q |
267 |
ccttcccggaccctgcatatgcgggagctctagtgcaccgg |
307 |
Q |
| |
|
||||| ||||||||| |||||| |||| ||||||||||| |
|
|
| T |
1850724 |
acttcctggaccctgcggatgcggaagctttagtgcaccgg |
1850764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 72; E-Value: 2e-32
Query Start/End: Original strand, 203 - 316
Target Start/End: Original strand, 20135623 - 20135740
Alignment:
| Q |
203 |
cctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctcta |
298 |
Q |
| |
|
|||| |||||||||||||||||||| || ||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||| |||||| | |
|
|
| T |
20135623 |
cctggaaacagcctcttgtgtaaaaaacaaggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcaggagcttca |
20135722 |
T |
 |
| Q |
299 |
gtgcaccgggttgccctt |
316 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
20135723 |
gtgcaccgggttgccctt |
20135740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 70; E-Value: 3e-31
Query Start/End: Original strand, 147 - 308
Target Start/End: Original strand, 39301087 - 39301249
Alignment:
| Q |
147 |
ccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtg--taaaacagggtaaggctgcgta |
244 |
Q |
| |
|
||||||||| || ||||||||||||||||||| ||| |||||||||||||||||||| || |||| ||||||||| ||||||||||||||| |||||| |
|
|
| T |
39301087 |
ccttggcgcaac-ggtaaagttgttgtcatgttactgaaaggtcacgggttcaagtcttgggaacaacctcttgtgtataaaacagggtaaggatgcgta |
39301185 |
T |
 |
| Q |
245 |
caatacacc-aaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccggg |
308 |
Q |
| |
|
||| |||| ||| ||||||||||||||||||||||| | |||| ||||| | |||||||||||| |
|
|
| T |
39301186 |
taatgcaccaaaaaggtgggaccccttcccggaccctccgtatgtgggag-tttagtgcaccggg |
39301249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 242 - 317
Target Start/End: Original strand, 16957374 - 16957449
Alignment:
| Q |
242 |
gtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
16957374 |
gtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
16957449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 137 - 242
Target Start/End: Original strand, 23974734 - 23974840
Alignment:
| Q |
137 |
tgaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggta |
234 |
Q |
| |
|
||||||||||||||||||| || ||||||||||||||||||||||| |||||||||||||||||||||| ||||| |||||||||| |||| |||||| |
|
|
| T |
23974734 |
tgaggggtaaccttggcgcaac-ggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaaaagagggta |
23974832 |
T |
 |
| Q |
235 |
aggctgcg |
242 |
Q |
| |
|
|||||||| |
|
|
| T |
23974833 |
aggctgcg |
23974840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 208 - 317
Target Start/End: Original strand, 29334419 - 29334531
Alignment:
| Q |
208 |
aaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacacca-aatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcac |
304 |
Q |
| |
|
|||||||||||||||||||| || |||||||||||||||||||||||| ||||||||||||| |||||||||||||| |||| |||| || || ||||| |
|
|
| T |
29334419 |
aaacagcctcttgtgtaaaaaacaaggtaaggctgcgtacaatacaccagaatggtgggacccattcccggaccctgcgtatgtgggatctttaatgcac |
29334518 |
T |
 |
| Q |
305 |
cgggttgcccttt |
317 |
Q |
| |
|
|||| |||||||| |
|
|
| T |
29334519 |
cgggctgcccttt |
29334531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 61; E-Value: 6e-26
Query Start/End: Original strand, 161 - 317
Target Start/End: Original strand, 3771318 - 3771474
Alignment:
| Q |
161 |
gtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggt |
260 |
Q |
| |
|
|||| |||||| ||| |||||| ||||||||| |||| ||||| || |||||| || | ||||||||||||||||| | |||||||||||| |||| |
|
|
| T |
3771318 |
gtaatgttgttctcacgtgactgaaaggtcacaggtttaagtcatgtaaacagtctgtgtaaaaaaacagggtaaggctgtgaacaatacaccaattggt |
3771417 |
T |
 |
| Q |
261 |
gggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
||||||||||||||||| ||| |||| ||||||| |||||||||||| |||||||| |
|
|
| T |
3771418 |
gggaccccttcccggactctgtgtatgtgggagctttagtgcaccgggctgcccttt |
3771474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 61; E-Value: 6e-26
Query Start/End: Original strand, 160 - 317
Target Start/End: Complemental strand, 24903855 - 24903696
Alignment:
| Q |
160 |
ggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaaca--gggtaaggctgcgtacaatacaccaaat |
257 |
Q |
| |
|
|||||| ||||||||| |||||| ||| |||| ||| ||||||||||||||||||| |||||||||| | ||||||| || ||||||| |||||| | |
|
|
| T |
24903855 |
ggtaaatttgttgtcacgtgactgaaaagtcatgggcacaagtcctgaaaacagccttttgtgtaaaaaatagggtaagattgtgtacaatccaccaatt |
24903756 |
T |
 |
| Q |
258 |
ggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|||| ||||||||||||||| ||||||| |||||| || | |||||||||| || ||||| |
|
|
| T |
24903755 |
ggtgagaccccttcccggacactgcatacgcgggaactttggtgcaccgggctgtccttt |
24903696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 258 - 317
Target Start/End: Complemental strand, 16028683 - 16028624
Alignment:
| Q |
258 |
ggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16028683 |
ggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
16028624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 176 - 317
Target Start/End: Complemental strand, 42924977 - 42924830
Alignment:
| Q |
176 |
tgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaaggctgcgtacaatacacc--aaatggtgggaccccttc |
271 |
Q |
| |
|
||||||| |||||||||| |||||||||||||||||| | |||||||| |||||||||||||| ||||||||||||||| ||||| ||| | |||||| |
|
|
| T |
42924977 |
tgtgactgaaaggtcacgagttcaagtcctgaaaacaacatcttgtgtaaaaaacagggtaaggttgcgtacaatacaccaaaaatgatggaatcccttc |
42924878 |
T |
 |
| Q |
272 |
ccgg--accctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|| | ||||||| ||||||| |||| ||||||||||| ||| ||||| |
|
|
| T |
42924877 |
ccagacaccctgcgtatgcggaagctttagtgcaccggattgtccttt |
42924830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 169 - 269
Target Start/End: Complemental strand, 22908014 - 22907913
Alignment:
| Q |
169 |
gttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt-aaaacagggtaaggctgcgtacaatacaccaaatggtgggaccc |
267 |
Q |
| |
|
||||| |||||||| |||||||| |||||||||||| |||||||||||||||| ||||||| |||||| ||| ||||||||||||||||||||||||| |
|
|
| T |
22908014 |
gttgttatgtgactgaaaggtcaagggttcaagtccaagaaacagcctcttgtgtaaaaacagagtaaggttgcatacaatacaccaaatggtgggaccc |
22907915 |
T |
 |
| Q |
268 |
ct |
269 |
Q |
| |
|
|| |
|
|
| T |
22907914 |
ct |
22907913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 258 - 319
Target Start/End: Complemental strand, 30877623 - 30877562
Alignment:
| Q |
258 |
ggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttaa |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
30877623 |
ggtgggaccccttcccggaccctgcatatgtgggagctctagtgcaccgggttgccctttaa |
30877562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 199 - 318
Target Start/End: Complemental strand, 5873441 - 5873321
Alignment:
| Q |
199 |
aagtcctgaaaacagcctcttgtgtaaaac-agggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctct |
297 |
Q |
| |
|
||||| || |||||||||||||||||||| ||||||||||| ||||| |||||||| ||||||||| ||| ||||||| |||| |||||||||||| | |
|
|
| T |
5873441 |
aagtcgtggaaacagcctcttgtgtaaaaatagggtaaggctaagtacactacaccaattggtgggactcctccccggacactgcgtatgcgggagcttt |
5873342 |
T |
 |
| Q |
298 |
agtgcaccgggttgcccttta |
318 |
Q |
| |
|
|||||| |||| ||||||||| |
|
|
| T |
5873341 |
agtgcatcgggatgcccttta |
5873321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 162 - 295
Target Start/End: Complemental strand, 24323862 - 24323727
Alignment:
| Q |
162 |
taaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatgg |
259 |
Q |
| |
|
|||||||||| || ||||||| ||| |||| |||||||| ||| ||||| |||||||||||||| ||||||||| |||||| ||||| |||||| | |
|
|
| T |
24323862 |
taaagttgttatcgtgtgactgaaatgtcaaatgttcaagttctggaaacaacctcttgtgtaaaagacagggtaagcttgcgtataatactccaaatag |
24323763 |
T |
 |
| Q |
260 |
tgggaccccttcccggaccctgcatatgcgggagct |
295 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
24323762 |
tgggaccccttcccagaccctgtatatgcgggagct |
24323727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 162 - 295
Target Start/End: Complemental strand, 24360486 - 24360351
Alignment:
| Q |
162 |
taaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatgg |
259 |
Q |
| |
|
|||||||||| || ||||||| ||| |||| |||||||| ||| ||||| |||||||||||||| ||||||||| |||||| ||||| |||||| | |
|
|
| T |
24360486 |
taaagttgttatcgtgtgactgaaatgtcaaatgttcaagttctggaaacaacctcttgtgtaaaagacagggtaagcttgcgtataatactccaaatag |
24360387 |
T |
 |
| Q |
260 |
tgggaccccttcccggaccctgcatatgcgggagct |
295 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
24360386 |
tgggaccccttcccagaccctgtatatgcgggagct |
24360351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 202 - 318
Target Start/End: Complemental strand, 12575779 - 12575659
Alignment:
| Q |
202 |
tcctgaaaacagcctcttgtgtaaa---acagggtaaggctgcgtacaatacaccaaa-tggtgggaccccttcccggaccctgcatatgcgggagctct |
297 |
Q |
| |
|
||||| ||||||||||||| ||||| ||||| ||| | |||||||||||||||||| |||||||||||||||| ||||||||| ||||| |||||| | |
|
|
| T |
12575779 |
tcctggaaacagcctcttgcgtaaataaacaggctaaagttgcgtacaatacaccaaaatggtgggaccccttcctggaccctgcgtatgcaggagcttt |
12575680 |
T |
 |
| Q |
298 |
agtgcaccgggttgcccttta |
318 |
Q |
| |
|
|||||||||| ||||||||| |
|
|
| T |
12575679 |
ggtgcaccgggctgcccttta |
12575659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 143 - 256
Target Start/End: Original strand, 31299591 - 31299705
Alignment:
| Q |
143 |
gtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgt-gtaaaacagggtaaggctgc |
241 |
Q |
| |
|
|||||||||| || |||||||||||||||||||||||||| | ||||||| ||||||||||| |||||||||||||| |||||||| |||| |||| |
|
|
| T |
31299591 |
gtaaccttggtgcaactggtaaagttgttgtcatgtgacttacaggtcactagttcaagtcctagaaacagcctcttgtattaaaacagtgtaaaactgc |
31299690 |
T |
 |
| Q |
242 |
gtacaatacaccaaa |
256 |
Q |
| |
|
|||||||||| |||| |
|
|
| T |
31299691 |
gtacaatacatcaaa |
31299705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 164 - 308
Target Start/End: Complemental strand, 34074717 - 34074573
Alignment:
| Q |
164 |
aagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaaggctgcgtacaatacaccaaatggtg |
261 |
Q |
| |
|
|||||||||||| ||||| ||||||||| ||||||||||| |||||||||||||||| |||||| |||||| ||||| ||||||||||||||| |
|
|
| T |
34074717 |
aagttgttgtcacatgactgaaaggtcacaagttcaagtcctagaaacagcctcttgtgtaaaaaacacagtaaggttgcgttcaatacaccaaatggca |
34074618 |
T |
 |
| Q |
262 |
ggaccccttcccggaccctgcatatgcgggagctctagtgcaccggg |
308 |
Q |
| |
|
|| ||||||||| ||||||| |||| ||||| ||||||||||||| |
|
|
| T |
34074617 |
gggccccttcccaaaccctgcgtatgggggag--ctagtgcaccggg |
34074573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 182 - 282
Target Start/End: Original strand, 41425946 - 41426048
Alignment:
| Q |
182 |
taaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccc |
279 |
Q |
| |
|
||||| ||||||||||||||| ||| ||||| | | |||||||||| |||||||||||||| ||||||||||||| ||||||||||||||||| ||| | |
|
|
| T |
41425946 |
taaaatgtcacgggttcaagttctggaaacaacttattgtgtaaaaaacagggtaaggctgcatacaatacaccaattggtgggaccccttcccagactc |
41426045 |
T |
 |
| Q |
280 |
tgc |
282 |
Q |
| |
|
||| |
|
|
| T |
41426046 |
tgc |
41426048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 255 - 317
Target Start/End: Original strand, 25622533 - 25622595
Alignment:
| Q |
255 |
aatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||| ||||||||||| ||||||||| |
|
|
| T |
25622533 |
aatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccggattgcccttt |
25622595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #48
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 232 - 317
Target Start/End: Complemental strand, 11657785 - 11657699
Alignment:
| Q |
232 |
gtaaggctgcgtacaatacaccaaa-tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|||||||||| |||||||||||||| |||||||||||||||||| |||||||| | |||||| || |||| ||||||| |||||||| |
|
|
| T |
11657785 |
gtaaggctgcatacaatacaccaaaatggtgggaccccttcccgaaccctgcacacgcgggaactttagttcaccgggctgcccttt |
11657699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #49
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 161 - 319
Target Start/End: Complemental strand, 31694266 - 31694106
Alignment:
| Q |
161 |
gtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaaca--gggtaaggctgcgtacaatacaccaaatg |
258 |
Q |
| |
|
||||||||||||||| |||||| | |||||| |||||||||| |||||| || | || |||||||| | || ||| ||||| ||||||||||| | || |
|
|
| T |
31694266 |
gtaaagttgttgtcacgtgactgataggtcataggttcaagtcttgaaaaaagtcactcgtgtaaaaaataggctaaagctgcatacaatacacctattg |
31694167 |
T |
 |
| Q |
259 |
gtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttaa |
319 |
Q |
| |
|
|||||| ||||||| |||| ||| |||||||||| | ||||||||| | |||||||||| |
|
|
| T |
31694166 |
atgggactccttcccagaccttgcgtatgcgggagatttagtgcaccagactgccctttaa |
31694106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #50
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 138 - 194
Target Start/End: Original strand, 19438703 - 19438759
Alignment:
| Q |
138 |
gaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgg |
194 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
19438703 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatatgactaaaagatcacgg |
19438759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #51
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 224 - 307
Target Start/End: Complemental strand, 9794471 - 9794388
Alignment:
| Q |
224 |
aaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgg |
307 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| |||||| |||||| | ||||| |||||||| | |||| ||||||||||| |
|
|
| T |
9794471 |
aaaacagggtaagactgcatacaatacaccaaatagtgggatcccttcacagacccagcatatgcagaagctttagtgcaccgg |
9794388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #52
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 247 - 317
Target Start/End: Complemental strand, 10943914 - 10943845
Alignment:
| Q |
247 |
atacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| ||||||||||| |||||||||||| |||||||| |
|
|
| T |
10943914 |
atacaccaaataacgggaccccttcccggaccctgca-atgcgggagctttagtgcaccgggctgcccttt |
10943845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #53
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 238 - 308
Target Start/End: Original strand, 13774921 - 13774991
Alignment:
| Q |
238 |
ctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccggg |
308 |
Q |
| |
|
||||| |||||||||||||||| ||| ||||| ||||||||||| |||||||||||| |||||||||||| |
|
|
| T |
13774921 |
ctgcgcacaatacaccaaatggcaggatccctttccggaccctgcgtatgcgggagctttagtgcaccggg |
13774991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #54
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 159 - 280
Target Start/End: Original strand, 18698586 - 18698707
Alignment:
| Q |
159 |
tggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaaggctgcgtacaata-caccaaat |
257 |
Q |
| |
|
||||||| | ||||||| |||| | || |||||||||||||||| |||||||||||||||||| |||||| |||| |||||| ||||||| | |||| |
|
|
| T |
18698586 |
tggtaaaatggttgtcacgtgattgaacggtcacgggttcaagtactgaaaacagcctcttgt-aaaaacaaggtacggctgcatacaatatgtcaaaat |
18698684 |
T |
 |
| Q |
258 |
ggtgggaccccttcccggaccct |
280 |
Q |
| |
|
|| ||||| |||||||||||||| |
|
|
| T |
18698685 |
ggcgggactccttcccggaccct |
18698707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #55
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 233 - 305
Target Start/End: Complemental strand, 12477205 - 12477132
Alignment:
| Q |
233 |
taaggctgcgtacaatacaccaaa-tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcacc |
305 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||| |||| ||||| ||||| ||||||||| |
|
|
| T |
12477205 |
taaggctgcgtacaatacaccaaaatggtgggaccccttcccggattctgcgtatgcaagagctttagtgcacc |
12477132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #56
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 244 - 295
Target Start/End: Complemental strand, 10306548 - 10306496
Alignment:
| Q |
244 |
acaatacaccaaa-tggtgggaccccttcccggaccctgcatatgcgggagct |
295 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
10306548 |
acaatacaccaaaatggtgggaccccttcccggaccctgcgtatgcgggagct |
10306496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #57
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 254 - 314
Target Start/End: Complemental strand, 21784395 - 21784335
Alignment:
| Q |
254 |
aaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccc |
314 |
Q |
| |
|
||||||||||||||||| ||||||||||| |||||||||| | |||||||||| ||||||| |
|
|
| T |
21784395 |
aaatggtgggacccctttccggaccctgcgtatgcgggaggtttagtgcaccgagttgccc |
21784335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #58
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 179 - 240
Target Start/End: Original strand, 22025538 - 22025601
Alignment:
| Q |
179 |
gactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaaggctg |
240 |
Q |
| |
|
|||| |||||||| |||||||||||||| |||||||||||||||| ||||||||||||||||| |
|
|
| T |
22025538 |
gactgaaaggtcatgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggctg |
22025601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #59
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 257 - 313
Target Start/End: Original strand, 39801591 - 39801647
Alignment:
| Q |
257 |
tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcc |
313 |
Q |
| |
|
||||||||||||||||| |||||| | |||||||||||| ||||||||||||||||| |
|
|
| T |
39801591 |
tggtgggaccccttcccagaccctacgtatgcgggagctttagtgcaccgggttgcc |
39801647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #60
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 273 - 316
Target Start/End: Original strand, 19438757 - 19438800
Alignment:
| Q |
273 |
cggaccctgcatatgcgggagctctagtgcaccgggttgccctt |
316 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
19438757 |
cggaccctgcatatgcgggagctctagtgcaccaggttgccctt |
19438800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #61
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 266 - 317
Target Start/End: Original strand, 32354211 - 32354262
Alignment:
| Q |
266 |
cccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|||||||||||||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
32354211 |
cccttcccggaccctgtgtatgcgggagctttagtgcaccgggttgcccttt |
32354262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #62
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 167 - 213
Target Start/End: Complemental strand, 9794511 - 9794465
Alignment:
| Q |
167 |
ttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacag |
213 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
9794511 |
ttgttgtcatgtgatcaaaaggtcacgggttcaagtcctgaaaacag |
9794465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #63
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 270 - 315
Target Start/End: Original strand, 11462913 - 11462958
Alignment:
| Q |
270 |
tcccggaccctgcatatgcgggagctctagtgcaccgggttgccct |
315 |
Q |
| |
|
||||| || ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11462913 |
tcccgaactctgcatatgcgggagctctagtgcaccgggttgccct |
11462958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #64
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 162 - 317
Target Start/End: Complemental strand, 24313732 - 24313572
Alignment:
| Q |
162 |
taaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctc-ttgtgta--aaacagggtaaggctgcgtacaatacaccaaa-t |
257 |
Q |
| |
|
|||||||||||||| ||||| |||||||| | ||||||||| || ||||| || | || |||| ||||| | ||||| ||||| |||||||||||| | |
|
|
| T |
24313732 |
taaagttgttgtcacatgactgaaaggtcatgtgttcaagtcttggaaacaacccccttctgtagaaaacaagataaggttgcgttcaatacaccaaaat |
24313633 |
T |
 |
| Q |
258 |
ggtgggaccccttcccgg-accctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|||||||||||||||||| || || ||||| | |||| |||||||||||| |||||||| |
|
|
| T |
24313632 |
ggtgggaccccttcccggcgccatgtgtatgctgtagctttagtgcaccgggctgcccttt |
24313572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #65
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 162 - 317
Target Start/End: Complemental strand, 24356069 - 24355909
Alignment:
| Q |
162 |
taaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctc-ttgtgta--aaacagggtaaggctgcgtacaatacaccaaa-t |
257 |
Q |
| |
|
|||||||||||||| ||||| |||||||| | ||||||||| || ||||| || | || |||| ||||| | ||||| ||||| |||||||||||| | |
|
|
| T |
24356069 |
taaagttgttgtcacatgactgaaaggtcatgtgttcaagtcttggaaacaacccccttctgtagaaaacaagataaggttgcgttcaatacaccaaaat |
24355970 |
T |
 |
| Q |
258 |
ggtgggaccccttcccgg-accctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|||||||||||||||||| || || ||||| | |||| |||||||||||| |||||||| |
|
|
| T |
24355969 |
ggtgggaccccttcccggcgccatgtgtatgctgtagctttagtgcaccgggctgcccttt |
24355909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #66
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 147 - 252
Target Start/End: Complemental strand, 10634317 - 10634211
Alignment:
| Q |
147 |
ccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgta |
244 |
Q |
| |
|
||||||||| || ||| |||||||||||| |||||| |||||||| ||||||||||||| ||||| |||| |||| |||| |||||||||||| ||| |
|
|
| T |
10634317 |
ccttggcgcaac-ggtgaagttgttgtcaagtgactgaaaggtcatgggttcaagtcctagaaacaacctcgtgtgcaaaaatcagggtaaggctcggta |
10634219 |
T |
 |
| Q |
245 |
caatacac |
252 |
Q |
| |
|
||||||| |
|
|
| T |
10634218 |
aaatacac |
10634211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #67
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 147 - 203
Target Start/End: Complemental strand, 39079937 - 39079882
Alignment:
| Q |
147 |
ccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtc |
203 |
Q |
| |
|
||||||||| || |||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
39079937 |
ccttggcgcaac-ggtaaagttgttgtcatgtgacagaaaggtcacgggttcaagtc |
39079882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #68
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 254 - 305
Target Start/End: Complemental strand, 4654478 - 4654427
Alignment:
| Q |
254 |
aaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcacc |
305 |
Q |
| |
|
||||||||||| |||||| || |||||||||||||||||||| ||||||||| |
|
|
| T |
4654478 |
aaatggtgggatcccttctcgaaccctgcatatgcgggagctttagtgcacc |
4654427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #69
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 252 - 295
Target Start/End: Complemental strand, 21542532 - 21542489
Alignment:
| Q |
252 |
ccaaatggtgggaccccttcccggaccctgcatatgcgggagct |
295 |
Q |
| |
|
|||||||||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
21542532 |
ccaaatggtgggaccccttcccggactctgcgtatgcgggagct |
21542489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #70
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 157 - 214
Target Start/End: Original strand, 17419887 - 17419944
Alignment:
| Q |
157 |
actggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagc |
214 |
Q |
| |
|
||||||||| ||||||| |||||||| |||||| ||| |||||||||||| ||||||| |
|
|
| T |
17419887 |
actggtaaaattgttgtaatgtgactgaaaggttacgagttcaagtcctggaaacagc |
17419944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #71
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 162 - 303
Target Start/End: Original strand, 18426017 - 18426160
Alignment:
| Q |
162 |
taaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaaggctgcgtacaatacaccaaatgg |
259 |
Q |
| |
|
|||||||||| | | |||||| ||| ||||| |||| ||||| |||||||| ||||||||| |||| || | |||| || |||||||||| | ||||| |
|
|
| T |
18426017 |
taaagttgttattacgtgactgaaatgtcacaggtttaagtcttgaaaacaatctcttgtgtaaaaaatagagaaaggttgtgtacaatacatcgaatgg |
18426116 |
T |
 |
| Q |
260 |
tgggaccccttcccggaccctgcatatgcgggagctctagtgca |
303 |
Q |
| |
|
|| |||||||| || || |||| |||||| ||||| ||||||| |
|
|
| T |
18426117 |
tgagaccccttttcgaactctgcgtatgcgagagctttagtgca |
18426160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #72
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 242 - 313
Target Start/End: Complemental strand, 39079827 - 39079755
Alignment:
| Q |
242 |
gtacaatacaccaaa-tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcc |
313 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||| || ||| |||||| | |||||||| ||| |||| |
|
|
| T |
39079827 |
gtacaatacaccaaaatggtgggaccccttcccggaccatgtgtatacgggagttttagtgcacagggctgcc |
39079755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #73
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 254 - 317
Target Start/End: Original strand, 19093885 - 19093948
Alignment:
| Q |
254 |
aaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
||||||| ||||||| |||||||||||| |||| |||||| |||||||||||| |||||||| |
|
|
| T |
19093885 |
aaatggtatgacccctacccggaccctgcgtatgttggagctttagtgcaccgggctgcccttt |
19093948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #74
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 137 - 176
Target Start/End: Original strand, 41956885 - 41956924
Alignment:
| Q |
137 |
tgaggggtaaccttggcgccactggtaaagttgttgtcat |
176 |
Q |
| |
|
||||||||||| ||||||| |||||||||||||||||||| |
|
|
| T |
41956885 |
tgaggggtaacattggcgcaactggtaaagttgttgtcat |
41956924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #75
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 232 - 304
Target Start/End: Complemental strand, 3176839 - 3176770
Alignment:
| Q |
232 |
gtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcac |
304 |
Q |
| |
|
|||||| ||||||||||||||||| ||||||||||| ||||||| ||| ||||| |||||| |||||||| |
|
|
| T |
3176839 |
gtaaggttgcgtacaatacaccaactggtgggaccc---cccggactctgtgtatgccggagctttagtgcac |
3176770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #76
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 161 - 267
Target Start/End: Original strand, 4809986 - 4810094
Alignment:
| Q |
161 |
gtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaaggctgcgtacaatacaccaaatg |
258 |
Q |
| |
|
||||||||||||||| ||| |||||| ||| || |||||||||| ||||| ||||||||| |||| ||| |||| |||| ||||||| | |||||| |
|
|
| T |
4809986 |
gtaaagttgttgtcacatgagtaaaagatcatggattcaagtccttgaaacaatctcttgtgtcaaaaataggttaagactgcatacaatagatcaaatg |
4810085 |
T |
 |
| Q |
259 |
gtgggaccc |
267 |
Q |
| |
|
|||||||| |
|
|
| T |
4810086 |
atgggaccc |
4810094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #77
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 231 - 300
Target Start/End: Original strand, 15141929 - 15141998
Alignment:
| Q |
231 |
ggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagt |
300 |
Q |
| |
|
|||| ||||| || ||||||| ||||||||||||||||||| | ||||||| ||| |||||||| |||| |
|
|
| T |
15141929 |
ggtagggctgtgtgcaatacatcaaatggtgggaccccttcttgaaccctgcttatacgggagctttagt |
15141998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #78
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 275 - 316
Target Start/End: Complemental strand, 29184103 - 29184062
Alignment:
| Q |
275 |
gaccctgcatatgcgggagctctagtgcaccgggttgccctt |
316 |
Q |
| |
|
|||| ||| |||||||||||| |||||||||||||||||||| |
|
|
| T |
29184103 |
gaccatgcgtatgcgggagctttagtgcaccgggttgccctt |
29184062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #79
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 159 - 200
Target Start/End: Complemental strand, 31362495 - 31362454
Alignment:
| Q |
159 |
tggtaaagttgttgtcatgtgactaaaaggtcacgggttcaa |
200 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
31362495 |
tggtaaagttgttgtcatgtgattggaaggtcacgggttcaa |
31362454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #80
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 242 - 317
Target Start/End: Complemental strand, 37226037 - 37225961
Alignment:
| Q |
242 |
gtacaatacaccaaa-tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|||||||||| |||| |||||||||||||||||| ||| ||| ||||| ||| | |||||||| || ||||||||| |
|
|
| T |
37226037 |
gtacaatacaacaaaatggtgggaccccttcccgaaccatgcgtatgccagaggtttagtgcactggattgcccttt |
37225961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0187 (Bit Score: 139; Significance: 2e-72; HSPs: 4)
Name: scaffold0187
Description:
Target: scaffold0187; HSP #1
Raw Score: 139; E-Value: 2e-72
Query Start/End: Original strand, 141 - 315
Target Start/End: Complemental strand, 10226 - 10052
Alignment:
| Q |
141 |
gggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaaggctg |
240 |
Q |
| |
|
||||||||||| ||| |||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||| ||||| ||| |
|
|
| T |
10226 |
gggtaaccttgacgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaacagagtaagactg |
10127 |
T |
 |
| Q |
241 |
cgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccct |
315 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
10126 |
cgtacaatacaccaaatagtgggaccccttcccggaccctgcatatgcaggagctccagtgcaccgggttgccct |
10052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0187; HSP #2
Raw Score: 139; E-Value: 2e-72
Query Start/End: Original strand, 141 - 315
Target Start/End: Complemental strand, 20554 - 20380
Alignment:
| Q |
141 |
gggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaaggctg |
240 |
Q |
| |
|
||||||||||| ||| |||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||| ||||| ||| |
|
|
| T |
20554 |
gggtaaccttgacgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaacagagtaagactg |
20455 |
T |
 |
| Q |
241 |
cgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccct |
315 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
20454 |
cgtacaatacaccaaatagtgggaccccttcccggaccctgcatatgcaggagctccagtgcaccgggttgccct |
20380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0187; HSP #3
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 137 - 203
Target Start/End: Original strand, 8898 - 8964
Alignment:
| Q |
137 |
tgaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtc |
203 |
Q |
| |
|
||||||||||||||||||| || ||| ||||||||||||||||||| ||| ||||| |||||||||| |
|
|
| T |
8898 |
tgaggggtaaccttggcgcaaccggtgaagttgttgtcatgtgactgaaatgtcacaggttcaagtc |
8964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0187; HSP #4
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 137 - 203
Target Start/End: Original strand, 19226 - 19292
Alignment:
| Q |
137 |
tgaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtc |
203 |
Q |
| |
|
||||||||||||||||||| || ||| ||||||||||||||||||| ||| ||||| |||||||||| |
|
|
| T |
19226 |
tgaggggtaaccttggcgcaaccggtgaagttgttgtcatgtgactgaaatgtcacaggttcaagtc |
19292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0223 (Bit Score: 130; Significance: 4e-67; HSPs: 1)
Name: scaffold0223
Description:
Target: scaffold0223; HSP #1
Raw Score: 130; E-Value: 4e-67
Query Start/End: Original strand, 145 - 318
Target Start/End: Original strand, 11093 - 11265
Alignment:
| Q |
145 |
aaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaaggctgcgta |
244 |
Q |
| |
|
||||||||||| ||||||||||||||| | |||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |||||||||| || |
|
|
| T |
11093 |
aaccttggcgcaactggtaaagttgttct-atgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaacaaagtaaggctgctta |
11191 |
T |
 |
| Q |
245 |
caatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttta |
318 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
11192 |
caatacaccaaatggtgggacaccttcccggaccctgcatatgcgggagctctagtgcaccaggttgcccttta |
11265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0258 (Bit Score: 123; Significance: 6e-63; HSPs: 1)
Name: scaffold0258
Description:
Target: scaffold0258; HSP #1
Raw Score: 123; E-Value: 6e-63
Query Start/End: Original strand, 140 - 317
Target Start/End: Complemental strand, 13202 - 13024
Alignment:
| Q |
140 |
ggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa-cagggtaaggc |
238 |
Q |
| |
|
|||||||||||||||| || ||||||||||||||||||||||| ||||||||| ||||||||||||| ||||||||||||| |||||| || |||||||| |
|
|
| T |
13202 |
ggggtaaccttggcgcaaccggtaaagttgttgtcatgtgactgaaaggtcaccggttcaagtcctggaaacagcctcttgcgtaaaaacaaggtaaggc |
13103 |
T |
 |
| Q |
239 |
tgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |||||||| |||||||| ||| ||||||||||||||||||||| |
|
|
| T |
13102 |
tgcgtacaatacaccgaatggtgggaccccttcccagaccctgcgtatgcgggggctttagtgcaccgggttgcccttt |
13024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0057 (Bit Score: 122; Significance: 2e-62; HSPs: 5)
Name: scaffold0057
Description:
Target: scaffold0057; HSP #1
Raw Score: 122; E-Value: 2e-62
Query Start/End: Original strand, 147 - 317
Target Start/End: Original strand, 46794 - 46966
Alignment:
| Q |
147 |
ccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaaca--gggtaaggctgcgta |
244 |
Q |
| |
|
||||||||| | ||||||||||||||||||||||||| |||||||||||||||||| ||| ||||| |||||||||||||| | |||||||| |||||| |
|
|
| T |
46794 |
ccttggcgcaattggtaaagttgttgtcatgtgactagaaggtcacgggttcaagtgctggaaacaacctcttgtgtaaaaaatagggtaaggttgcgta |
46893 |
T |
 |
| Q |
245 |
caatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
46894 |
caatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
46966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0057; HSP #2
Raw Score: 116; E-Value: 9e-59
Query Start/End: Original strand, 137 - 317
Target Start/End: Complemental strand, 24949 - 24772
Alignment:
| Q |
137 |
tgaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggta |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||| |||||||| ||||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
24949 |
tgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcatgggttcaagtc-----aacagcctcttgtgtaaaaaacagggta |
24855 |
T |
 |
| Q |
235 |
aggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||| ||||||| |||||||||||| ||||||| | ||||||||||| |
|
|
| T |
24854 |
aggctgcgtacaacacaccaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcagccggttgcccttt |
24772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0057; HSP #3
Raw Score: 86; E-Value: 7e-41
Query Start/End: Original strand, 197 - 317
Target Start/End: Original strand, 43672 - 43793
Alignment:
| Q |
197 |
tcaagtcctgaaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggacccc-ttcccggaccctgcatatgcgggagct |
295 |
Q |
| |
|
|||||| ||| ||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
43672 |
tcaagttctggaaacagcgtcttgtgtaaaacaaggtaaggctgcgtacaatacaccaaatggtgggacccctttctcggaccctgcatatgcgggagct |
43771 |
T |
 |
| Q |
296 |
ctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
||||||||| | |||||||||| |
|
|
| T |
43772 |
ctagtgcactgagttgcccttt |
43793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0057; HSP #4
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 229 - 295
Target Start/End: Complemental strand, 46796 - 46729
Alignment:
| Q |
229 |
agggtaaggctgcgtacaatacaccaaa-tggtgggaccccttcccggaccctgcatatgcgggagct |
295 |
Q |
| |
|
||||||||| ||| ||||||| |||||| ||||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
46796 |
agggtaaggatgcatacaatataccaaaatggtgggaccccttcccagaccctgcgtatgcgggagct |
46729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0057; HSP #5
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 161 - 206
Target Start/End: Complemental strand, 47041 - 46996
Alignment:
| Q |
161 |
gtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctg |
206 |
Q |
| |
|
||||||||||||||| |||||| |||||||||| |||||||||||| |
|
|
| T |
47041 |
gtaaagttgttgtcaggtgactgaaaggtcacgagttcaagtcctg |
46996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1176 (Bit Score: 117; Significance: 2e-59; HSPs: 1)
Name: scaffold1176
Description:
Target: scaffold1176; HSP #1
Raw Score: 117; E-Value: 2e-59
Query Start/End: Original strand, 146 - 318
Target Start/End: Complemental strand, 1758 - 1586
Alignment:
| Q |
146 |
accttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaaggctgcgtac |
245 |
Q |
| |
|
|||||| ||| | |||||||||||||||||||||||| |||||||| |||||||||||||||||||| |||||||||||||||||| ||||||||| ||| |
|
|
| T |
1758 |
accttgacgcaattggtaaagttgttgtcatgtgactgaaaggtcatgggttcaagtcctgaaaacaacctcttgtgtaaaacaggataaggctgcatac |
1659 |
T |
 |
| Q |
246 |
aatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttta |
318 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| || |||||||||||| ||||||||| ||||||| |||| |
|
|
| T |
1658 |
aatacaccaaatgatgggaccccttcccggacccggcgtatgcgggagctttagtgcaccaggttgcctttta |
1586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0015 (Bit Score: 113; Significance: 6e-57; HSPs: 1)
Name: scaffold0015
Description:
Target: scaffold0015; HSP #1
Raw Score: 113; E-Value: 6e-57
Query Start/End: Original strand, 193 - 317
Target Start/End: Complemental strand, 48758 - 48634
Alignment:
| Q |
193 |
gggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcggga |
292 |
Q |
| |
|
|||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48758 |
gggttcaagtggtggaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcggga |
48659 |
T |
 |
| Q |
293 |
gctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
48658 |
gctctagtgcaccgggttgcccttt |
48634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0311 (Bit Score: 110; Significance: 3e-55; HSPs: 1)
Name: scaffold0311
Description:
Target: scaffold0311; HSP #1
Raw Score: 110; E-Value: 3e-55
Query Start/End: Original strand, 147 - 317
Target Start/End: Original strand, 10773 - 10945
Alignment:
| Q |
147 |
ccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgta |
244 |
Q |
| |
|
|||||| || |||||||||||||||||||||||||| ||||||||||||||||| ||||||||| |||||||||||||| ||||||| |||||||| |
|
|
| T |
10773 |
ccttggtgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaaggtctgaaaacaacctcttgtgtaaaaaacagggtagggctgcgtc |
10872 |
T |
 |
| Q |
245 |
caatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||| ||||||| |||| |
|
|
| T |
10873 |
caatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcactgggttgctcttt |
10945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0049 (Bit Score: 106; Significance: 9e-53; HSPs: 1)
Name: scaffold0049
Description:
Target: scaffold0049; HSP #1
Raw Score: 106; E-Value: 9e-53
Query Start/End: Original strand, 143 - 318
Target Start/End: Original strand, 58936 - 59115
Alignment:
| Q |
143 |
gtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaaggctg |
240 |
Q |
| |
|
|||||||||| || ||||||||| || ||||||||||||| ||||||||||||||||||||||| |||||||||||||| | ||||||||||||| ||| |
|
|
| T |
58936 |
gtaaccttggagcaactggtaaacttattgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtataaaaaacagggtaagactg |
59035 |
T |
 |
| Q |
241 |
cgtacaatacacc--aaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttta |
318 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||| |||| |||||||||||| ||||||| |||||||||||||| |
|
|
| T |
59036 |
cgtacaatacaccaaaaatggtgggaccccttcccagactctgcgtatgcgggagctttagtgcatcgggttgcccttta |
59115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0180 (Bit Score: 84; Significance: 1e-39; HSPs: 1)
Name: scaffold0180
Description:
Target: scaffold0180; HSP #1
Raw Score: 84; E-Value: 1e-39
Query Start/End: Original strand, 230 - 317
Target Start/End: Complemental strand, 24220 - 24133
Alignment:
| Q |
230 |
gggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
24220 |
gggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccggattgcccttt |
24133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005 (Bit Score: 84; Significance: 1e-39; HSPs: 1)
Name: scaffold0005
Description:
Target: scaffold0005; HSP #1
Raw Score: 84; E-Value: 1e-39
Query Start/End: Original strand, 136 - 266
Target Start/End: Complemental strand, 226589 - 226456
Alignment:
| Q |
136 |
ctgaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt---aaaacaggg |
232 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||||||||||||||| ||||||||||| |||||||||| |||||||||||||| | ||||||||| |
|
|
| T |
226589 |
ctgagtggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacggattcaagtcctagaaacagcctcttgtctaaaaaaacaggg |
226490 |
T |
 |
| Q |
233 |
taaggctgcgtacaatacaccaaatggtgggacc |
266 |
Q |
| |
|
||||||||| ||||||||| |||||||||||||| |
|
|
| T |
226489 |
taaggctgcatacaatacatcaaatggtgggacc |
226456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0036 (Bit Score: 81; Significance: 7e-38; HSPs: 1)
Name: scaffold0036
Description:
Target: scaffold0036; HSP #1
Raw Score: 81; E-Value: 7e-38
Query Start/End: Original strand, 138 - 272
Target Start/End: Complemental strand, 35200 - 35062
Alignment:
| Q |
138 |
gaggggtaaccttggcgccactggtaaagttg-ttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt---aaaacagggt |
233 |
Q |
| |
|
||||| |||| |||| || |||||||||||| ||||||||||||| ||||||||||||||||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
35200 |
gagggataactttggtgcaactggtaaagtttattgtcatgtgactgtaaggtcacgggttcaagtcctgaaaacagtctcttgtgtgtgaaaacagggt |
35101 |
T |
 |
| Q |
234 |
aaggctgcgtacaatacaccaaatggtgggaccccttcc |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
35100 |
aaggctgcgtacaatacaccaaatggtgggaccctttcc |
35062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0018 (Bit Score: 78; Significance: 4e-36; HSPs: 1)
Name: scaffold0018
Description:
Target: scaffold0018; HSP #1
Raw Score: 78; E-Value: 4e-36
Query Start/End: Original strand, 146 - 317
Target Start/End: Complemental strand, 73034 - 72867
Alignment:
| Q |
146 |
accttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaaca-gcctcttgtgtaaaa--cagggtaaggctgcg |
242 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |||||||||||||||||| ||||| | ||||||||||||| || ||||||||||| |
|
|
| T |
73034 |
accttggcgcaactggtaaagttgttgtcatgtgt-------gtcacgggttcaagtcctagaaacaagtctcttgtgtaaaaaacacggtaaggctgcc |
72942 |
T |
 |
| Q |
243 |
tacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|||||||||||||||||| | ||||||||||||| ||||| |||||||||||| ||||||||| ||||||||||| |
|
|
| T |
72941 |
tacaatacaccaaatggtagtaccccttcccggaacctgcgtatgcgggagctttagtgcaccaggttgcccttt |
72867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0254 (Bit Score: 74; Significance: 1e-33; HSPs: 1)
Name: scaffold0254
Description:
Target: scaffold0254; HSP #1
Raw Score: 74; E-Value: 1e-33
Query Start/End: Original strand, 143 - 280
Target Start/End: Original strand, 4117 - 4258
Alignment:
| Q |
143 |
gtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaa--acagggtaaggctg |
240 |
Q |
| |
|
||||||||| ||| ||| ||||||||||||| |||||||| ||||||||||||||||||||||| ||||| ||||||||||||| ||||| ||||| || |
|
|
| T |
4117 |
gtaaccttg-cgcaactagtaaagttgttgttatgtgactgaaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaatacaggataaggttg |
4215 |
T |
 |
| Q |
241 |
cgtacaatacacc---aaatggtgggaccccttcccggaccct |
280 |
Q |
| |
|
||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
4216 |
cgtacaatacaccaataattggtgggaccccttcccggaccct |
4258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0954 (Bit Score: 58; Significance: 4e-24; HSPs: 1)
Name: scaffold0954
Description:
Target: scaffold0954; HSP #1
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 200 - 318
Target Start/End: Original strand, 3560 - 3680
Alignment:
| Q |
200 |
agtcctgaaaacagcctcttgtgtaaaacag--ggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctct |
297 |
Q |
| |
|
||||||| ||| |||||||||||||||| | |||||||||||||| |||||||| |||| ||||||||||||||| ||||||| ||||||| |||| | |
|
|
| T |
3560 |
agtcctggaaagagcctcttgtgtaaaatataaggtaaggctgcgtataatacaccgaatgatgggaccccttcccgaaccctgcgtatgcggcagcttt |
3659 |
T |
 |
| Q |
298 |
agtgcaccgggttgcccttta |
318 |
Q |
| |
|
||||||||| ||| ||||||| |
|
|
| T |
3660 |
agtgcaccgagtttcccttta |
3680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024 (Bit Score: 56; Significance: 6e-23; HSPs: 1)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 137 - 212
Target Start/End: Original strand, 83828 - 83903
Alignment:
| Q |
137 |
tgaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaaca |
212 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||||||||||||||| |||||||||||||||||||| || ||||| |
|
|
| T |
83828 |
tgaggggtaaccttggcgcaactagtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcttggaaaca |
83903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0167 (Bit Score: 52; Significance: 1e-20; HSPs: 1)
Name: scaffold0167
Description:
Target: scaffold0167; HSP #1
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 175 - 295
Target Start/End: Original strand, 23590 - 23712
Alignment:
| Q |
175 |
atgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcc |
272 |
Q |
| |
|
|||||||| ||||| ||||||||||||| || ||||| |||||||||||||| |||||| |||||||||||||| | |||||||||||||||||||| |
|
|
| T |
23590 |
atgtgactgaaagggtacgggttcaagtcttgcaaacaacctcttgtgtaaaaaacagggtgaggctgcgtacaatgtagcaaatggtgggaccccttcc |
23689 |
T |
 |
| Q |
273 |
cggaccctgcatatgcgggagct |
295 |
Q |
| |
|
| |||| || |||| ||||||| |
|
|
| T |
23690 |
cagaccttgagtatgtgggagct |
23712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0194 (Bit Score: 48; Significance: 3e-18; HSPs: 1)
Name: scaffold0194
Description:
Target: scaffold0194; HSP #1
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 139 - 317
Target Start/End: Original strand, 24619 - 24783
Alignment:
| Q |
139 |
aggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaaggc |
238 |
Q |
| |
|
||||||||||||||| | | || |||||||||||||| |||||| |||||||||||||||||||||| |||||||| ||||||| | |
|
|
| T |
24619 |
aggggtaaccttggcacaattgataaagttgttgtcaagtgactgtaaggtcacgggttcaagtcctggaaacagcc--------------gggtaagac |
24704 |
T |
 |
| Q |
239 |
tgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
317 |
Q |
| |
|
|||||| |||||||||||| |||| |||||| || |||||||| ||| |||||||| |||||||| | ||||||||| |
|
|
| T |
24705 |
tgcgtataatacaccaaatagtggaccccctttccagaccctgcgtatacgggagcttcagtgcacctgattgcccttt |
24783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0031 (Bit Score: 45; Significance: 2e-16; HSPs: 1)
Name: scaffold0031
Description:
Target: scaffold0031; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 142 - 227
Target Start/End: Original strand, 43085 - 43172
Alignment:
| Q |
142 |
ggtaaccttggcgcc--actggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa |
227 |
Q |
| |
|
|||||||||||||| |||||||||||| ||||||||||| | |||||||||| ||||| ||||| |||||||||||||||||||| |
|
|
| T |
43085 |
ggtaaccttggcgcgcaactggtaaagttattgtcatgtgattgaaaggtcacgagttcaggtcctagaaacagcctcttgtgtaaaa |
43172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0116 (Bit Score: 44; Significance: 8e-16; HSPs: 1)
Name: scaffold0116
Description:
Target: scaffold0116; HSP #1
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 138 - 227
Target Start/End: Original strand, 8848 - 8934
Alignment:
| Q |
138 |
gaggggtaaccttggcgccactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa |
227 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||||||||||||| |||||||| ||||||| ||||| ||||| | |||||||||||| |
|
|
| T |
8848 |
gaggggtaaccttgacgc---tggtaaagttgttgtcatgtgactgtaaggtcacaggttcaattcctggaaacaacttcttgtgtaaaa |
8934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0867 (Bit Score: 43; Significance: 0.000000000000003; HSPs: 1)
Name: scaffold0867
Description:
Target: scaffold0867; HSP #1
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 188 - 301
Target Start/End: Complemental strand, 3798 - 3685
Alignment:
| Q |
188 |
gtcacgggttcaagtcctgaaaacagcctcttgtgtaaa-acagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatat |
286 |
Q |
| |
|
|||| |||||||||| ||||||||| || |||||||||| ||| ||||| | ||||||||||||||||||||||||||||| || | || | || |||| |
|
|
| T |
3798 |
gtcatgggttcaagttctgaaaacaacc-cttgtgtaaatacaaggtaacgttgcgtacaatacaccaaatggtgggacccttttctcgatcttgtatat |
3700 |
T |
 |
| Q |
287 |
gcgggagctctagtg |
301 |
Q |
| |
|
||||||||| ||||| |
|
|
| T |
3699 |
gcgggagctttagtg |
3685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0050 (Bit Score: 36; Significance: 0.00000000005; HSPs: 1)
Name: scaffold0050
Description:
Target: scaffold0050; HSP #1
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 247 - 318
Target Start/End: Complemental strand, 58699 - 58629
Alignment:
| Q |
247 |
atacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttta |
318 |
Q |
| |
|
||||||| ||||||| ||||||||| ||||||||| |||||||||||||| ||||||| || ||||||||| |
|
|
| T |
58699 |
atacaccgaatggtgagaccccttctcggaccctgtgtatgcgggagctct-gtgcaccaggctgcccttta |
58629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0028 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold0028
Description:
Target: scaffold0028; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 160 - 267
Target Start/End: Original strand, 32906 - 33016
Alignment:
| Q |
160 |
ggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaaggctgcgtacaatacaccaaa- |
256 |
Q |
| |
|
|||| |||||||| || |||||| |||||||| |||||||||||| ||| | |||||| ||| ||||||| ||||| ||| |||||||||||||| |
|
|
| T |
32906 |
ggtatagttgttgccacgtgacttaaaggtcatgggttcaagtccgcgaaaaaacctcttctgtaaaaaacagagtaagactgtatacaatacaccaaat |
33005 |
T |
 |
| Q |
257 |
tggtgggaccc |
267 |
Q |
| |
|
||||||||||| |
|
|
| T |
33006 |
tggtgggaccc |
33016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University