View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1408_low_145 (Length: 285)
Name: NF1408_low_145
Description: NF1408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1408_low_145 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 72 - 220
Target Start/End: Complemental strand, 54262511 - 54262363
Alignment:
| Q |
72 |
ttggtttgccttgcagttgatactctattgtagctcataattaccaatacatcgtcttattagttgtagtagaaaactaggtgcgtgcataccaacaatt |
171 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54262511 |
ttggtttgccttgcagttgatactctattgtagctcataattaccaatacatcgtcttattagttgtagtagaaaactaggtgcgtgcataccaacaatt |
54262412 |
T |
|
| Q |
172 |
cttcaacgcttcgatgaatgaaattcttcaatgcttcatgttcatatca |
220 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54262411 |
cttcaatgcttcgatgaatgaaattcttcaatgcttcatgttcatatca |
54262363 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University