View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1408_low_154 (Length: 272)
Name: NF1408_low_154
Description: NF1408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1408_low_154 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 5 - 161
Target Start/End: Complemental strand, 43184417 - 43184261
Alignment:
| Q |
5 |
gtgtcaatggtcagtttttatgtcccccagttctttgtatgttttcatctttggatttcgtaacataaaccatgatgagtgtgatcatctacaattgtta |
104 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
43184417 |
gtgtcaatggtcaggttttatgtcccccagttctttgtatgctttcatctttggatttcgtaacataaaccatgatgagtgtgatcatctacagttgtta |
43184318 |
T |
|
| Q |
105 |
gaaaatagaaatagatgtgaatagaggtgataacaagtcgactcctggtgtctatat |
161 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43184317 |
gaaaatagaaatagatgtgaatagaggtgataacaagtcgactcctggtgtctatat |
43184261 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University