View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1408_low_159 (Length: 264)
Name: NF1408_low_159
Description: NF1408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1408_low_159 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 25 - 223
Target Start/End: Original strand, 27098713 - 27098911
Alignment:
| Q |
25 |
agtgagatgaagtaattgaaattcttcacacacactactgagtaagagaggaattagcattaccagtagaaggatcagaagaatttgagaaacaagaatt |
124 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27098713 |
agtgaaatgaagtaattgaaattcttcacacacactactgagtaagagaggaattagcattaccagtagaaggatcagaagaatttgagaaacaagaatt |
27098812 |
T |
|
| Q |
125 |
cttatgattatgcatccaaaccttaaaaacttgtctactcacaccaacactttcacaaaaccttccaatctcttcatcaagttcttttctctgcaattt |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
27098813 |
cttatgattatgcatccaaaccttaaaaacttgtctactcacaccaacactttcacaaaacctttcaatctcttcatcaagttcttttctctgcaattt |
27098911 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University