View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1408_low_162 (Length: 262)
Name: NF1408_low_162
Description: NF1408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1408_low_162 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 1 - 256
Target Start/End: Complemental strand, 15888170 - 15887915
Alignment:
| Q |
1 |
aaatgacattatctatctaattatgcagtattctcctttagtttttcataggtttcctccacttgagataatcgagtaaatggttttttcataacctaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15888170 |
aaatgacattatctatctaattatgcagtattctcctttagtttttcataggtttcctccacttgagataatcgagtaaatggttttttcataacctaag |
15888071 |
T |
 |
| Q |
101 |
aacatcaaccgttcctgatttcaaaattacttcattcatatgaatccagatggactaaattatggccaacactatccagatcgacaatgttaccaccgaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
15888070 |
aacatcaaccgttcctgatttcaaaattacttcattcatatgaatccagatggactaaattatgaccaacactatccagatcgacaatgttaccaccgaa |
15887971 |
T |
 |
| Q |
201 |
atctagcacaagcgactggtgcgtaaggtgtgtgagtattgtaaaccctatgatac |
256 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
15887970 |
atctagcacaagcggctggtgcgtaaggtgtgtgagtattgtaaaccctaggatac |
15887915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University