View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1408_low_169 (Length: 260)

Name: NF1408_low_169
Description: NF1408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1408_low_169
NF1408_low_169
[»] chr4 (2 HSPs)
chr4 (164-260)||(47348195-47348291)
chr4 (41-78)||(47348072-47348109)


Alignment Details
Target: chr4 (Bit Score: 97; Significance: 9e-48; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 164 - 260
Target Start/End: Original strand, 47348195 - 47348291
Alignment:
164 ttcattaccttcaacacatgggggcaaaaggtcaccagtttcagttgtctcatctcttcttataattgtgttaacagcatcattgagtcggtcccat 260  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47348195 ttcattaccttcaacacatgggggcaaaaggtcaccagtttcagttgtctcatctcttcttataattgtgttaacagcatcattgagtcggtcccat 47348291  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 41 - 78
Target Start/End: Original strand, 47348072 - 47348109
Alignment:
41 cacatcactaccagctcaataacacataaaatcagctc 78  Q
    |||| |||||||||||||||||||||||||||||||||    
47348072 cacaacactaccagctcaataacacataaaatcagctc 47348109  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University