View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1408_low_180 (Length: 252)
Name: NF1408_low_180
Description: NF1408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1408_low_180 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 142; Significance: 1e-74; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 30 - 192
Target Start/End: Original strand, 47586703 - 47586865
Alignment:
| Q |
30 |
cttttttgtatgtcgtgggaacttgtaacatgattgtggctcaaaattctttnnnnnnncgtagtaaatcattctttactacagaaaatgacaaatgtat |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47586703 |
cttttttgtatgtcgtgggaacttgtaacatgattgtggctcaaaattctttaaaaaaacgtagtaaatcattctttactacagaaaatgacaaatgtat |
47586802 |
T |
 |
| Q |
130 |
acaatttaaatatttaccgtgtaattaaggtttatgaatcccttccatttttaacattaacat |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47586803 |
acaatttaaatatttaccgtgtaattaaggtttatgaatcccttccatttttaacattaacat |
47586865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 212 - 252
Target Start/End: Original strand, 47586891 - 47586931
Alignment:
| Q |
212 |
atatttgtgagattggaggacatacttaaaatcacgtactt |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47586891 |
atatttgtgagattggaggacatacttaaaatcacgtactt |
47586931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University