View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1408_low_188 (Length: 250)
Name: NF1408_low_188
Description: NF1408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1408_low_188 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 134; Significance: 7e-70; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 107 - 248
Target Start/End: Original strand, 10982934 - 10983075
Alignment:
| Q |
107 |
gaaattgtgattcggataaattgggctcctttaatttatttgtttttgtaataaataggtggtttaattcataaatatttgcacaattatccttttctac |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
10982934 |
gaaattgtgattcggataaattgggctcctttaatttatttgtttttgtaataaataggtggtttaattcataaatatttgcacaattatccttttccat |
10983033 |
T |
|
| Q |
207 |
acaaattattttaaaagtgctcagcgatactatttctttatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10983034 |
acaaattattttaaaagtgctcagcgatactatttctttatg |
10983075 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University