View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1408_low_194 (Length: 248)
Name: NF1408_low_194
Description: NF1408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1408_low_194 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 106; Significance: 4e-53; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 1 - 110
Target Start/End: Original strand, 27066937 - 27067046
Alignment:
| Q |
1 |
gggaagcagaagagatgggcggcggagcagaactccggcagctttgtggagagtgtgttggcggccgcgtgttttgtgaatgtcgcggcttcggtggcgc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27066937 |
gggaagcagaagagatgggcggcggagcagaattccggcagctttgtggagagtgtgttggcggccgcgtgttttgtgaatgtcgcggcttcggtggcgc |
27067036 |
T |
 |
| Q |
101 |
tgagtggtga |
110 |
Q |
| |
|
|||||||||| |
|
|
| T |
27067037 |
tgagtggtga |
27067046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 13 - 112
Target Start/End: Original strand, 27080633 - 27080732
Alignment:
| Q |
13 |
agatgggcggcggagcagaactccggcagctttgtggagagtgtgttggcggccgcgtgttttgtgaatgtcgcggcttcggtggcgctgagtggtgatg |
112 |
Q |
| |
|
|||||||| || |||||||||||||||| ||||||||||||||||||||| ||||||||||| | || | ||||| |||||||||||||||||||||| |
|
|
| T |
27080633 |
agatgggcagccgagcagaactccggcaactttgtggagagtgtgttggctgccgcgtgtttcgcaaaagccgcggtctcggtggcgctgagtggtgatg |
27080732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 71
Target Start/End: Original strand, 27053748 - 27053818
Alignment:
| Q |
1 |
gggaagcagaagagatgggcggcggagcagaactccggcagctttgtggagagtgtgttggcggccgcgtg |
71 |
Q |
| |
|
||||||||||||||||| ||||| |||||||| ||||||| ||||||||| | |||||||||||| ||||| |
|
|
| T |
27053748 |
gggaagcagaagagatgtgcggcagagcagaattccggcaactttgtggataatgtgttggcggcagcgtg |
27053818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University