View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1408_low_200 (Length: 237)
Name: NF1408_low_200
Description: NF1408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1408_low_200 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 95; Significance: 1e-46; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 1 - 95
Target Start/End: Complemental strand, 37053873 - 37053779
Alignment:
| Q |
1 |
agtctttgttgctttttgatttgatagggaattttactccacctataatctcgttgttatctctttcttcttttatcttaggccctcattgttat |
95 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37053873 |
agtctttgttgctttttgatttgatagggaattttactccacctataatctcgttgttatctctttcttcttttatcttaggccctcattgttat |
37053779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 161 - 229
Target Start/End: Complemental strand, 37053714 - 37053646
Alignment:
| Q |
161 |
ctactacgtcggtgtttaaagaaacattattgcatcaaggtcaagcatcccatacttgttagaataatc |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
37053714 |
ctactacgtcggtgtttaaagaaacattattgcatcaaggtcaagcatcccatacttgttagattaatc |
37053646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University