View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1408_low_205 (Length: 234)

Name: NF1408_low_205
Description: NF1408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1408_low_205
NF1408_low_205
[»] chr8 (1 HSPs)
chr8 (103-225)||(39793431-39793553)


Alignment Details
Target: chr8 (Bit Score: 52; Significance: 6e-21; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 103 - 225
Target Start/End: Original strand, 39793431 - 39793553
Alignment:
103 ctctccctgcaacaggtttgtttctactttccaaaaaaaggggactgagcnnnnnnnnngataccatcatacgaagtggtgggttgcnnnnnnnncccta 202  Q
    ||||||||||||||||||||||||||||||||| ||||| ||||||||||         ||||||||||||||||||||| ||||||         ||||    
39793431 ctctccctgcaacaggtttgtttctactttccacaaaaatgggactgagcacaactaaagataccatcatacgaagtggtaggttgccaagaaaaaccta 39793530  T
203 cgattaccgccgctaagtataat 225  Q
    | |||||||||||||||||||||    
39793531 caattaccgccgctaagtataat 39793553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University