View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1408_low_215 (Length: 229)
Name: NF1408_low_215
Description: NF1408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1408_low_215 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 101; Significance: 3e-50; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 1 - 101
Target Start/End: Complemental strand, 16723587 - 16723487
Alignment:
| Q |
1 |
caatttttacagacagaaccaaaccaaatgtgatcaattggttcaattaacttctcaacaatcatgttgagagcaagtgaatctaagtttgcccaatctc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16723587 |
caatttttacagacagaaccaaaccaaatgtgatcaattggttcaattaacttctcaacaatcatgttgagagcaagtgaatctaagtttgcccaatctc |
16723488 |
T |
 |
| Q |
101 |
g |
101 |
Q |
| |
|
| |
|
|
| T |
16723487 |
g |
16723487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 1 - 101
Target Start/End: Complemental strand, 16741976 - 16741876
Alignment:
| Q |
1 |
caatttttacagacagaaccaaaccaaatgtgatcaattggttcaattaacttctcaacaatcatgttgagagcaagtgaatctaagtttgcccaatctc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||| ||||||||||||||| |||||||||||||||||||| |||| |
|
|
| T |
16741976 |
caatttttacagacagaaccaaaccaaatatgatcaattggttcagttaacttctcaagaatcatgttgagagcgagtgaatctaagtttgcccagtctc |
16741877 |
T |
 |
| Q |
101 |
g |
101 |
Q |
| |
|
| |
|
|
| T |
16741876 |
g |
16741876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University