View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1408_low_229 (Length: 225)
Name: NF1408_low_229
Description: NF1408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1408_low_229 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 129; Significance: 6e-67; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 1 - 140
Target Start/End: Original strand, 46229395 - 46229535
Alignment:
| Q |
1 |
tctcctctacatctttctcctt-actttcacctaatagttgaagtttttgggatacaattgattcctatatatgaaacatgaaatctgagctagccttca |
99 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
46229395 |
tctcctctacatctttctcctttactttcacctaatagttgaagtttttgggatacaattgattcctatatatgtaacatgaaatctgagctagccttca |
46229494 |
T |
 |
| Q |
100 |
agccacatatttatgcaacttggttttcattgtggcctatg |
140 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46229495 |
agccacatatttatgcaacttggttttcattgtggcctatg |
46229535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University