View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1408_low_242 (Length: 219)
Name: NF1408_low_242
Description: NF1408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1408_low_242 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 89; Significance: 5e-43; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 1 - 105
Target Start/End: Original strand, 1481018 - 1481122
Alignment:
| Q |
1 |
tagcctttcttgagtttagtataagaaagctcgcgaaaaaagacttttagcctttcttgagttgtatgtgttatgtactatggagtattaagtatgtgat |
100 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
1481018 |
tagcctttcttgagtttagaataagaaagctcgcgaaaaaagacttttagcctttcttgagttgtatgtgttatgtactacggagtgttaagtatgtgat |
1481117 |
T |
 |
| Q |
101 |
gatgt |
105 |
Q |
| |
|
|||| |
|
|
| T |
1481118 |
aatgt |
1481122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 15 - 63
Target Start/End: Original strand, 1480984 - 1481033
Alignment:
| Q |
15 |
tttagtataagaaagctcgcgaaaaa-agacttttagcctttcttgagtt |
63 |
Q |
| |
|
||||||||||||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
1480984 |
tttagtataagaaagctcgtgaaaaacagacttttagcctttcttgagtt |
1481033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University