View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1408_low_246 (Length: 218)
Name: NF1408_low_246
Description: NF1408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1408_low_246 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 109; Significance: 5e-55; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 64 - 191
Target Start/End: Complemental strand, 29215455 - 29215325
Alignment:
| Q |
64 |
ttaaatactaattcacatttgctaagtatatgcgtattattacacatgtgttcgaaatgtttattttgcaatgcactttcatgtaggccttaataaacgc |
163 |
Q |
| |
|
|||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29215455 |
ttaagtactaattcacatgtgctaagtatatgcgtattattacacatgtgttcgaaatgtttattttgcaatgcactttcatgtaggccttaataaacgc |
29215356 |
T |
|
| Q |
164 |
aatg---caagagcgtcgacaagtattctta |
191 |
Q |
| |
|
|||| |||||||||||||||||||||||| |
|
|
| T |
29215355 |
aatgcaacaagagcgtcgacaagtattctta |
29215325 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University