View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1408_low_261 (Length: 211)

Name: NF1408_low_261
Description: NF1408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1408_low_261
NF1408_low_261
[»] chr5 (2 HSPs)
chr5 (54-139)||(42634714-42634799)
chr5 (1-33)||(42634828-42634860)


Alignment Details
Target: chr5 (Bit Score: 70; Significance: 1e-31; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 54 - 139
Target Start/End: Complemental strand, 42634799 - 42634714
Alignment:
54 ttcatgtataattcatagtcgggaagagcatgttgtataatggggattttagcattttatattagttatggaagatattattggag 139  Q
    |||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||    
42634799 ttcatgtataattctttgtcgggaagagcatgttgtataatggggattttagcattttatattagttatggaagatgttgttggag 42634714  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 33
Target Start/End: Complemental strand, 42634860 - 42634828
Alignment:
1 attacacacagaaatctctatacaacacagaaa 33  Q
    |||||||||||||||||||||||||| ||||||    
42634860 attacacacagaaatctctatacaacgcagaaa 42634828  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University