View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1408_low_268 (Length: 209)
Name: NF1408_low_268
Description: NF1408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1408_low_268 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 147; Significance: 1e-77; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 1 - 180
Target Start/End: Complemental strand, 27944381 - 27944202
Alignment:
| Q |
1 |
aacaaatagatgcatgacatgtggaattagttgacggttaaagggaaactgatactagttaggatttttctaggttgttgcttcatgtcggtgtcatgtg |
100 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27944381 |
aacaaatagatgcatgacacgtggaattagttgacggttaaagggaaactgata---gttaggatttttctaggttgttgcttcatgtcggtgtcatgtg |
27944285 |
T |
|
| Q |
101 |
gataaatttccttatgggcttttaggttgccagaattatgcagaactaattcaatc---ttctgcaagtgagattagcatggg |
180 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
27944284 |
gataaatttcctaatgggcttttaggttgccagaattatgcagaactaattcaatcttcttctgcaagtgagattagcatggg |
27944202 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 60 - 106
Target Start/End: Original strand, 27550626 - 27550672
Alignment:
| Q |
60 |
taggatttttctaggttgttgcttcatgtcggtgtcatgtggataaa |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
27550626 |
taggatttttctaggttgttgcttcatgtcggtgtcatgtgaataaa |
27550672 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 56 - 97
Target Start/End: Complemental strand, 27435783 - 27435742
Alignment:
| Q |
56 |
tagttaggatttttctaggttgttgcttcatgtcggtgtcat |
97 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |||||||| |
|
|
| T |
27435783 |
tagttaggatttttctaggctgttgcttcatgtaggtgtcat |
27435742 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University