View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1408_low_277 (Length: 204)
Name: NF1408_low_277
Description: NF1408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1408_low_277 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 48; Significance: 1e-18; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 43 - 102
Target Start/End: Complemental strand, 48325541 - 48325482
Alignment:
| Q |
43 |
attttgcagtgacaaagcatactttgttgatctatttgtgagagcatcaaatgcaccagc |
102 |
Q |
| |
|
||||| |||||||||||| || |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48325541 |
atttttcagtgacaaagcctattttgttgatctatttgtgagagcatcaaatgcaccagc |
48325482 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University