View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1408_low_278 (Length: 203)
Name: NF1408_low_278
Description: NF1408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1408_low_278 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 110; Significance: 1e-55; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 1 - 122
Target Start/End: Complemental strand, 2753467 - 2753346
Alignment:
| Q |
1 |
atcattcccatgattattattttacttcaaatgtttcttgttttttatatcaattaatttgtggatttcagaataaacaaaagaagatgatggcaatcaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2753467 |
atcattcccatgattattattttacttcaaatgtttcttgttttttatatcaataaatttctggatttcagaataaacaaaagaagatgatggcaatcaa |
2753368 |
T |
 |
| Q |
101 |
atgactagctcatattgttgga |
122 |
Q |
| |
|
||||||||||||||||| |||| |
|
|
| T |
2753367 |
atgactagctcatattggtgga |
2753346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University