View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1408_low_32 (Length: 458)
Name: NF1408_low_32
Description: NF1408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1408_low_32 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 94; Significance: 1e-45; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 94; E-Value: 1e-45
Query Start/End: Original strand, 87 - 224
Target Start/End: Original strand, 36446142 - 36446279
Alignment:
| Q |
87 |
agaacctgtgatactgtaaccaaaaaagaacatgtgatactacctattacttatgatactccctatccctatactattgattatatgatgtacttggttc |
186 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| || ||||||||||||||||||| ||||||||| |
|
|
| T |
36446142 |
agaacctgtgatactgtaaccaaaaaagaacctgtgatactacctattacttatgatactccctatacccatactattgattatatgatctacttggttt |
36446241 |
T |
 |
| Q |
187 |
aactcttatcnnnnnnnncttagataatttaagtttgg |
224 |
Q |
| |
|
|||||||||| |||||||||||||||||||| |
|
|
| T |
36446242 |
aactcttatcttttttatcttagataatttaagtttgg |
36446279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 79; E-Value: 9e-37
Query Start/End: Original strand, 361 - 455
Target Start/End: Original strand, 36446387 - 36446479
Alignment:
| Q |
361 |
gcacatgttaaaatttcctttaacatgaccctaccaattttaatttgaaaaagattggaagagagtgagcaaaggagtggaacctatgatactac |
455 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
36446387 |
gcacatgttaaaatttcctt-aacatgaccctaccaattttaatttgaaaaagattggaagagagtgagc-aaggagtggaacctatgatactac |
36446479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 30 - 64
Target Start/End: Original strand, 913229 - 913263
Alignment:
| Q |
30 |
gttgttatatactatcatcaatgcctttcttcttg |
64 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
913229 |
gttgttatatactatcatcaatgcctttcttcttg |
913263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University