View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1408_low_33 (Length: 457)
Name: NF1408_low_33
Description: NF1408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1408_low_33 |
 | |
|
| [»] scaffold0446 (1 HSPs) |
| | |
|
Alignment Details
Target: chr4 (Bit Score: 333; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 333; E-Value: 0
Query Start/End: Original strand, 76 - 428
Target Start/End: Original strand, 56049080 - 56049432
Alignment:
| Q |
76 |
caacaatatcgataactattgcgaaaatcaatcaatgcacattaaggtgggctatcaaatatttacttttgatggatatttagctacaaagtgtcggttc |
175 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56049080 |
caacaaaatcgataactattgcgaaaatcaatcaatgcacattaaggtgggctatcaaatatttacttttgatggatatttagctacaaagtgtcggttc |
56049179 |
T |
|
| Q |
176 |
ccctagagttcacttggctgaaaattcgctctccaaccttcatgaactgggttaaatactggcacgcggatggatatttagctacaaagtgaagcaaaag |
275 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
56049180 |
ccctagagtccacttggctgaaaattcgctctccaaccttcatgaactgggttaaatactggcacaccgatggatatttagctacaaagtgaagcaaaag |
56049279 |
T |
|
| Q |
276 |
taccaagacaatgtggcgtggtgctaacagtgggttagtcaaaggcactgctaagatgaagctagaagtacaagggatcagctcagctcctctcaggcac |
375 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
56049280 |
taccaagacaatgtggcgtggtgctaacagtgggttagtcaaaggcactgctaagatgaagctagaagtacaaggtatcagctcagctcctctcaggcac |
56049379 |
T |
|
| Q |
376 |
ttcatgagtacctttctggattacaagggaaacaataatttaaaagacctgtc |
428 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56049380 |
ttcatgagtacctttctggattacaagggaaacaataatttaaaagacctgtc |
56049432 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0446 (Bit Score: 76; Significance: 6e-35; HSPs: 1)
Name: scaffold0446
Description:
Target: scaffold0446; HSP #1
Raw Score: 76; E-Value: 6e-35
Query Start/End: Original strand, 76 - 155
Target Start/End: Original strand, 14400 - 14479
Alignment:
| Q |
76 |
caacaatatcgataactattgcgaaaatcaatcaatgcacattaaggtgggctatcaaatatttacttttgatggatatt |
155 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14400 |
caacaaaatcgataactattgcgaaaatcaatcaatgcacattaaggtgggctatcaaatatttacttttgatggatatt |
14479 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University