View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1408_low_49 (Length: 432)
Name: NF1408_low_49
Description: NF1408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1408_low_49 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 45; Significance: 2e-16; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 255 - 299
Target Start/End: Complemental strand, 52853759 - 52853715
Alignment:
| Q |
255 |
gccatgggatagaatgtgctctagggacagttcagggcatcttgt |
299 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52853759 |
gccatgggatagaatgtgctctagggacagttcagggcatcttgt |
52853715 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 45; Significance: 2e-16; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 239 - 299
Target Start/End: Complemental strand, 48491053 - 48490993
Alignment:
| Q |
239 |
aagtttgataatccttgccatgggatagaatgtgctctagggacagttcagggcatcttgt |
299 |
Q |
| |
|
||||||||||| |||||||||||||||||| |||||| |||||| |||||||||||||||| |
|
|
| T |
48491053 |
aagtttgataacccttgccatgggatagaaggtgctccagggacggttcagggcatcttgt |
48490993 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 193 - 239
Target Start/End: Complemental strand, 48483535 - 48483489
Alignment:
| Q |
193 |
attattctccatgagtcatttagcctgggaagatgtaatttaatgga |
239 |
Q |
| |
|
||||||||||| ||||||||||| || |||||||||||||||||||| |
|
|
| T |
48483535 |
attattctccacgagtcatttagtctcggaagatgtaatttaatgga |
48483489 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University