View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1408_low_60 (Length: 395)
Name: NF1408_low_60
Description: NF1408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1408_low_60 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 320; Significance: 1e-180; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 320; E-Value: 1e-180
Query Start/End: Original strand, 29 - 387
Target Start/End: Original strand, 39062454 - 39062810
Alignment:
| Q |
29 |
acaaaataagtcatttcatgtcttgattttgtaaaataaaaaattatgtatccatttttaatttctctttgttatataaggtttaattcttttgaattgt |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39062454 |
acaaaataagtcatttcatgtcttgattttgtaaaataaaaaattatgtatccatttttaatttctctttgttatataaggtttaattcttttgaattgt |
39062553 |
T |
|
| Q |
129 |
ctctaaactccaatattatcatgtgaaagacctcacacatgcttttcacttgtaggtcgcaattgagtatctgtcttgaaatgagagctatacaggaggt |
228 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39062554 |
ctctaaactccaatattataatgtgaaagacctcaaacatattgttcacttgtaggtcgcaattgagtatctgtcttgaaatgagagctatacaggaggt |
39062653 |
T |
|
| Q |
229 |
acatccttcatattttcctagtcttctaattgagtgctttcattgcattgttctttccatgggaccctagcaaccatccataaaacttccttaagctctc |
328 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||| |
|
|
| T |
39062654 |
acatccttcatatttttctagtcttctaattgagtgctttcattgcattgttctttccatgggaccctagcaaccacccataaaacttccttaag--ctc |
39062751 |
T |
|
| Q |
329 |
tattctaggatatttatctcatcaattgccatataaatgtttcacacacaacctttgct |
387 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39062752 |
tattctaggatatttatctcatcaattgccatataaatgtttcacacacaacctttgct |
39062810 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University