View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1408_low_61 (Length: 393)
Name: NF1408_low_61
Description: NF1408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1408_low_61 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 96 - 385
Target Start/End: Original strand, 13792855 - 13793144
Alignment:
| Q |
96 |
gagaataaaaggttgttacagatttttctaaggtctttccagcgttgagagataggtataaatggtaaactgtagttatggtggtttgcacctttcattg |
195 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||| |
|
|
| T |
13792855 |
gagaataaaaggttgttacatatttttctaaggtctttccagcgttgagagataggtataaatggtaaactgtaattatggtggttagcacctttcattg |
13792954 |
T |
|
| Q |
196 |
catcggggattgttctattagagagagattggtcgttgatttgaaggactgatttgacggtttctgtggaggacataactatggtagttattcggcccaa |
295 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13792955 |
catcggggattgttctattagagagagaatggtcgttgatttgaaggactgatttgacagtttctgtggaggacataactatggtagttattcggcccaa |
13793054 |
T |
|
| Q |
296 |
ttttaaggacattattgggccgtggattttggagagttttgcgagggtttggtggggcttttgacccagttgatggagattgcctatgat |
385 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13793055 |
ttttaaggacattattgggccgtggattttggagagttttgcgagggtttggtggggcttttgacccagttgatggagattgcctatgat |
13793144 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University