View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1408_low_73 (Length: 368)
Name: NF1408_low_73
Description: NF1408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1408_low_73 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 9 - 55
Target Start/End: Complemental strand, 116333 - 116287
Alignment:
| Q |
9 |
gtggattcctaacagaagaagacatgaatcaaatggtagaattgatt |
55 |
Q |
| |
|
||||||| ||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
116333 |
gtggatttctaacggaagaagacatgaatcaaatggtagaattgatt |
116287 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University