View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1408_low_79 (Length: 358)
Name: NF1408_low_79
Description: NF1408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1408_low_79 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 129 - 347
Target Start/End: Original strand, 48485111 - 48485329
Alignment:
| Q |
129 |
ttatataggttctcatatcagaagtcgtttcacttgtgaaccaagccatatttgttaagaattttgtctgcagcatggagaggaaatcaaaatattttaa |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48485111 |
ttatataggttctcatatcagaagtcgtttcacttgtgaaccaagccatatttgttaagaattttgtctgcagcatggagaggaaatcaaaatattttaa |
48485210 |
T |
|
| Q |
229 |
ttaggctatcaaaccataaaatataaaataagtgttgaaggcttacaaatgaagctttggaaagtatattcctttcatgtcattgcacaccaccgctaga |
328 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48485211 |
ttaggctatcaaaccctaaaatataaaataagtgttgaaggattacaaatgaagctttggaaagtatattcctttcatgtcattgcacaccaccgctaga |
48485310 |
T |
|
| Q |
329 |
ttttcagtgaacacaggtt |
347 |
Q |
| |
|
||||||| |||||||||| |
|
|
| T |
48485311 |
ttttcaggtaacacaggtt |
48485329 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 262 - 323
Target Start/End: Complemental strand, 10035615 - 10035554
Alignment:
| Q |
262 |
gttgaaggcttacaaatgaagctttggaaagtatattcctttcatgtcattgcacaccaccg |
323 |
Q |
| |
|
||||| ||||||||||||||||||||| | ||| ||||||| ||| ||||||||||||||| |
|
|
| T |
10035615 |
gttgatggcttacaaatgaagctttgggatgtaaattccttccattccattgcacaccaccg |
10035554 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University