View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1408_low_81 (Length: 357)
Name: NF1408_low_81
Description: NF1408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1408_low_81 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 95; Significance: 2e-46; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 10 - 128
Target Start/End: Complemental strand, 39793553 - 39793435
Alignment:
| Q |
10 |
attatacttagcggcggtaatcgtagggttttcttggcaacctaccacttcgtatgatggtatcttttgttgtgctcagttccatttttgtggaaaggag |
109 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||| || |
|
|
| T |
39793553 |
attatacttagcggcggtaattgtaggtttttcttggcaacctaccacttcgtatgatggtatctttagttgtgctcagtcccatttttgtggaaagtag |
39793454 |
T |
|
| Q |
110 |
aaacaaaactgttgcaggg |
128 |
Q |
| |
|
||||||| ||||||||||| |
|
|
| T |
39793453 |
aaacaaacctgttgcaggg |
39793435 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University