View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1408_low_88 (Length: 350)
Name: NF1408_low_88
Description: NF1408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1408_low_88 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 73 - 350
Target Start/End: Original strand, 49123145 - 49123422
Alignment:
| Q |
73 |
tccaacaatatggagggcagaaaactgatagaccggtcttcttgtggttccaacacaacctctagctgtgaagagactgatgcgctagagaaggatgaga |
172 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49123145 |
tccaacaaaatggagggcagaaaactgatagaccggtcttcttgtggttccaacacaacctctagctgtgaagagactgatgcgctagagaaggatgaga |
49123244 |
T |
 |
| Q |
173 |
aagaaaaggaagaatgtaaaatacctgatgcagaccatttagctactgatcctagtagtcgtcgatatagaagcattagcaaccttcttgattcttggaa |
272 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49123245 |
aagaaaaggaagaatgtaaaatacctgatgcggaccatttagctaccgatcctagtagtcgtcgatatagaagcattagcaaccttcttgattcttggaa |
49123344 |
T |
 |
| Q |
273 |
ggaggtgtctgaagaggtatcaatatatctcgcaatgaaatgtaatttaatgtgttgtatacatgtattgcttctgtc |
350 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49123345 |
ggaggtgtctgaagaggtatcaatatatctcacaatgaaatgtaatttaatgtgttgtatacatgtattgcttctgtc |
49123422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University