View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14090_high_2 (Length: 319)
Name: NF14090_high_2
Description: NF14090
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14090_high_2 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 137; Significance: 2e-71; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 137; E-Value: 2e-71
Query Start/End: Original strand, 1 - 169
Target Start/End: Original strand, 8922778 - 8922947
Alignment:
| Q |
1 |
attaacaattataaaaccatattatgaaattttaaataattttacgacgttttagtttttggcaatatattatcttttaaaagcatctccaatgctcact |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8922778 |
attaacaattataaaaccatattacgaaattttaaataattttacgacgttttagtttttggcaatatattatcttttaaaagcatctccaatgctcact |
8922877 |
T |
 |
| Q |
101 |
tttttaacaaaataacgtttgcatgtttaga-nnnnnnnggtggtgctttgcatgtttagattgagaaca |
169 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
8922878 |
tttttaacaaaataacgtttgcatgtttagattttttttggtggtgctttgcatgtttagattgagaaca |
8922947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University