View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14090_low_2 (Length: 319)

Name: NF14090_low_2
Description: NF14090
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14090_low_2
NF14090_low_2
[»] chr2 (1 HSPs)
chr2 (1-169)||(8922778-8922947)


Alignment Details
Target: chr2 (Bit Score: 137; Significance: 2e-71; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 137; E-Value: 2e-71
Query Start/End: Original strand, 1 - 169
Target Start/End: Original strand, 8922778 - 8922947
Alignment:
1 attaacaattataaaaccatattatgaaattttaaataattttacgacgttttagtttttggcaatatattatcttttaaaagcatctccaatgctcact 100  Q
    |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8922778 attaacaattataaaaccatattacgaaattttaaataattttacgacgttttagtttttggcaatatattatcttttaaaagcatctccaatgctcact 8922877  T
101 tttttaacaaaataacgtttgcatgtttaga-nnnnnnnggtggtgctttgcatgtttagattgagaaca 169  Q
    |||||||||||||||||||||||||||||||        |||||||||||||||||||||||||||||||    
8922878 tttttaacaaaataacgtttgcatgtttagattttttttggtggtgctttgcatgtttagattgagaaca 8922947  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University