View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14091_high_2 (Length: 216)
Name: NF14091_high_2
Description: NF14091
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14091_high_2 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 18 - 202
Target Start/End: Complemental strand, 39395699 - 39395515
Alignment:
| Q |
18 |
ctttagtgtatcatcttctacaataatttctttattaacaacctcttcattattcccccctttgtgttgctgcttatgtggtgttatcatgtcttttata |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39395699 |
ctttagtgtatcatcttctacaataatttctttattaacaacctcttcattattcccccctttgtgttgctgcttatgtggtgttatcatgtcttttata |
39395600 |
T |
|
| Q |
118 |
ttaagactaaaagttttgcttaaactttttgattctttaggctccttatgatgttgttctcctgagtgatgatgatgcccctttg |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39395599 |
ttaagactaaaagttttgcttaaactttttgattctttaggctccttatgatgttgttctcctgagtgatgatgatgcccctttg |
39395515 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University