View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14091_low_2 (Length: 283)
Name: NF14091_low_2
Description: NF14091
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14091_low_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 21 - 268
Target Start/End: Original strand, 53251658 - 53251905
Alignment:
| Q |
21 |
aaaaatcttagcttggggctacccaaaccaagcattttggagctcaaaaaaccagcgtcaaccatgtcaaagctgaagttttggaagaaaagggtagtca |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53251658 |
aaaaatcttagcttggggctacccaaaccaagcattttggagctcaaaaaaccagcgtcaaccatgtcaaagctgaagttttggaagaaaagggtagtca |
53251757 |
T |
 |
| Q |
121 |
aaatcaaaagcaagaagccacaagaagtttgttttcatgaagattttgatgtactatcaagattggattgtagctctgattctgagtctatggtgtcgcc |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53251758 |
aaatcaaaagcaagaagccacaagaagtttgttttcatgaagattttgatatactatcaagattggattgtagctctgattctgagtctatggtgtcgcc |
53251857 |
T |
 |
| Q |
221 |
ccgtggttcaagcttttcatcttcctcttcgtcgatgtcgttgatgaa |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
53251858 |
ccgtggttcaagcttttcatcttcctcttcttcgatgtcgttgatgaa |
53251905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University