View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14091_low_3 (Length: 232)
Name: NF14091_low_3
Description: NF14091
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14091_low_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 107; Significance: 9e-54; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 103 - 213
Target Start/End: Original strand, 31166147 - 31166257
Alignment:
| Q |
103 |
ttgacaatttctcttcttatcttcaaacatataactctctccaaccttctcatatctttatagaatccaaattccaatttcaaaccattcacttgtcaca |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
31166147 |
ttgacaatttctcttcttatcttcaaacatataactctctccaaccttctcatatctttatagaatccaaattccaatttcaaaccattcactcgtcaca |
31166246 |
T |
 |
| Q |
203 |
cacaacaaagt |
213 |
Q |
| |
|
||||||||||| |
|
|
| T |
31166247 |
cacaacaaagt |
31166257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 8 - 74
Target Start/End: Original strand, 31166051 - 31166119
Alignment:
| Q |
8 |
tcgaagaatatgggataagccaaaaacagaaaatcataggc--aattaagaaagaaatgtcactctccg |
74 |
Q |
| |
|
||||| || |||||||||||||||||||||||| || |||| |||||||||||||||||||||||||| |
|
|
| T |
31166051 |
tcgaataaaatgggataagccaaaaacagaaaaacagaggcaaaattaagaaagaaatgtcactctccg |
31166119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University