View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14092_high_7 (Length: 223)
Name: NF14092_high_7
Description: NF14092
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14092_high_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 20 - 206
Target Start/End: Original strand, 50324610 - 50324796
Alignment:
| Q |
20 |
agagaagtagagaaccattcccaaaaggaccaccatggagagcaggtgaaaagcttcagttgatacataaagacatatgtggatctatgaagcctgagca |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50324610 |
agagaagtagagaaccattcccaaaaggaccaccatggagagcaggtgaaaagcttcagttgatacataaagacatatgtggatctatgaagcctgagca |
50324709 |
T |
 |
| Q |
120 |
aacaacaaagaggcgtttcctttcatcgcttatattaagtagaaagacatgtattttagcgatgtttatgtttgtttgggatttgat |
206 |
Q |
| |
|
||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50324710 |
aacaacaaagaggcgtttcatttcatcacttatattaagtagaaagacatgtattttagcgatgtttatgtttgtttgggatttgat |
50324796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University