View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14092_low_5 (Length: 459)
Name: NF14092_low_5
Description: NF14092
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14092_low_5 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 90; Significance: 3e-43; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 90; E-Value: 3e-43
Query Start/End: Original strand, 213 - 302
Target Start/End: Complemental strand, 37213134 - 37213045
Alignment:
| Q |
213 |
atcaagatcccgcctctatcccctagttttgttgtttttcaaaacctaaacccaaaaaatcacacaaaccccgctctcaccactttcccg |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37213134 |
atcaagatcccgcctctatcccctagttttgttgtttttcaaaacctaaacccaaaaaatcacacaaaccccgctctcaccactttcccg |
37213045 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 81; E-Value: 6e-38
Query Start/End: Original strand, 1 - 108
Target Start/End: Complemental strand, 37213347 - 37213242
Alignment:
| Q |
1 |
tgaatcagtatattcaaaattttgcttcagttttaattgaactcttgttgatgaatgatatatgatagattttttagattaattattcattgaattagat |
100 |
Q |
| |
|
|||||||||||||| |||||||||||||| |||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37213347 |
tgaatcagtatatttaaaattttgcttcaattttaattgaactcctgttgatgaatg--atatgatagattttttagattaattattcattgaattagat |
37213250 |
T |
|
| Q |
101 |
accgagtt |
108 |
Q |
| |
|
| |||||| |
|
|
| T |
37213249 |
atcgagtt |
37213242 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University