View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14094_low_11 (Length: 228)
Name: NF14094_low_11
Description: NF14094
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14094_low_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 19 - 218
Target Start/End: Original strand, 53562358 - 53562557
Alignment:
| Q |
19 |
tttgggaagattaaagttgccggcgtttttgttctacgagtggacgtggaatcccaaggactgtttgatgcggtgaggttgttttgtttgggagagctgc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53562358 |
tttgggaagattaaagttgccggcgtttttgttctacgagtggaagtggaatcccaaggactgtttgatgcggtgaggttgttttgtttgggagagctgc |
53562457 |
T |
|
| Q |
119 |
tgctgcgtggtgtctggctgtgttcattgaggttgtgcagttctgttgtggtgctgctggtttttctgtttgcagcagctcttatgctttctgtgttgct |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53562458 |
tgctgcgtggtgtctggctgtgttcattgaggctgtgcagttctgttgtggtgctgctggtttttctgtttgcagcagctcttatgctttctgtgttgct |
53562557 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University